Incidental Mutation 'R4374:Ppp6r2'
ID325049
Institutional Source Beutler Lab
Gene Symbol Ppp6r2
Ensembl Gene ENSMUSG00000036561
Gene Nameprotein phosphatase 6, regulatory subunit 2
SynonymsPp6r2, Saps2, 1110033O10Rik, 8430411H09Rik, B230107H12Rik
MMRRC Submission 041118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R4374 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89211553-89287010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89265158 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 216 (C216W)
Ref Sequence ENSEMBL: ENSMUSP00000154087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088788] [ENSMUST00000226221] [ENSMUST00000228284]
Predicted Effect probably damaging
Transcript: ENSMUST00000088788
AA Change: C216W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086167
Gene: ENSMUSG00000036561
AA Change: C216W

DomainStartEndE-ValueType
Pfam:SAPS 128 365 1.7e-73 PFAM
Pfam:SAPS 361 534 2.4e-47 PFAM
low complexity region 606 618 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 867 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226875
Predicted Effect probably damaging
Transcript: ENSMUST00000228284
AA Change: C216W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS2, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS2 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Abhd2 A G 7: 79,323,530 M86V probably benign Het
Acin1 C A 14: 54,653,894 probably benign Het
Aebp2 T A 6: 140,654,258 probably benign Het
Akap13 A G 7: 75,608,984 E452G probably damaging Het
Amz1 T C 5: 140,752,439 S184P possibly damaging Het
Ccdc83 A T 7: 90,226,778 L295* probably null Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cpsf7 A T 19: 10,539,637 I368F probably damaging Het
Csf1r G A 18: 61,119,006 C520Y probably damaging Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fktn T C 4: 53,720,201 S72P probably damaging Het
Frem2 C A 3: 53,545,502 V2189F possibly damaging Het
Gm10845 G T 14: 79,863,123 noncoding transcript Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lama1 A G 17: 67,804,518 M2255V probably benign Het
Lrsam1 G T 2: 32,955,191 T104K possibly damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Myo7a G A 7: 98,102,674 T54M probably damaging Het
Olfr178 A C 16: 58,889,879 C114G probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pfkp A G 13: 6,620,989 S135P probably damaging Het
Phf20l1 C T 15: 66,604,837 T260I possibly damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Pramel7 C T 2: 87,490,071 A293T probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Sh2b3 G T 5: 121,828,486 probably benign Het
Tbc1d30 A G 10: 121,294,712 F271S probably damaging Het
Tpo T C 12: 30,103,152 E401G possibly damaging Het
Zdhhc13 T C 7: 48,808,841 Y308H probably damaging Het
Zfp112 C T 7: 24,126,373 H589Y probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Ppp6r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ppp6r2 APN 15 89285813 missense probably benign 0.44
IGL00480:Ppp6r2 APN 15 89265249 splice site probably benign
IGL01061:Ppp6r2 APN 15 89286015 splice site probably benign
IGL01116:Ppp6r2 APN 15 89281989 missense probably damaging 1.00
IGL01317:Ppp6r2 APN 15 89285928 missense possibly damaging 0.62
IGL01947:Ppp6r2 APN 15 89278726 missense probably damaging 1.00
IGL01969:Ppp6r2 APN 15 89275510 missense probably damaging 0.99
IGL01999:Ppp6r2 APN 15 89269952 missense probably benign 0.09
IGL02634:Ppp6r2 APN 15 89275477 nonsense probably null
IGL02697:Ppp6r2 APN 15 89256755 missense probably benign 0.38
IGL02964:Ppp6r2 APN 15 89259175 missense probably damaging 1.00
IGL03107:Ppp6r2 APN 15 89268545 missense probably damaging 0.98
IGL03195:Ppp6r2 APN 15 89268555 missense possibly damaging 0.50
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0183:Ppp6r2 UTSW 15 89285787 missense probably damaging 0.99
R0745:Ppp6r2 UTSW 15 89265242 critical splice donor site probably null
R0835:Ppp6r2 UTSW 15 89268582 missense possibly damaging 0.90
R0959:Ppp6r2 UTSW 15 89274176 missense possibly damaging 0.81
R1661:Ppp6r2 UTSW 15 89253051 missense possibly damaging 0.96
R1867:Ppp6r2 UTSW 15 89281938 missense probably benign 0.01
R2081:Ppp6r2 UTSW 15 89282129 missense probably benign 0.01
R2102:Ppp6r2 UTSW 15 89278746 missense probably damaging 1.00
R2291:Ppp6r2 UTSW 15 89275487 missense probably damaging 1.00
R2900:Ppp6r2 UTSW 15 89281995 missense probably damaging 1.00
R3805:Ppp6r2 UTSW 15 89265639 missense probably benign 0.30
R3965:Ppp6r2 UTSW 15 89259114 missense probably benign 0.20
R4901:Ppp6r2 UTSW 15 89259069 missense possibly damaging 0.88
R5055:Ppp6r2 UTSW 15 89282949 missense probably benign 0.01
R5668:Ppp6r2 UTSW 15 89280399 missense probably damaging 1.00
R5739:Ppp6r2 UTSW 15 89259073 missense probably benign 0.02
R6026:Ppp6r2 UTSW 15 89282910 missense probably benign 0.02
R6058:Ppp6r2 UTSW 15 89253252 critical splice donor site probably null
R6488:Ppp6r2 UTSW 15 89268538 missense probably benign 0.12
R6631:Ppp6r2 UTSW 15 89253255 splice site probably null
R6633:Ppp6r2 UTSW 15 89253255 splice site probably null
R6744:Ppp6r2 UTSW 15 89256661 critical splice acceptor site probably null
R7149:Ppp6r2 UTSW 15 89262396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATCCATATCTTGATGATGGGC -3'
(R):5'- GGCTCTGAACCTGAGGAGTTAG -3'

Sequencing Primer
(F):5'- CCATATCTTGATGATGGGCAAAGC -3'
(R):5'- AATTAGTGATGGCAGTGTCATCTCC -3'
Posted On2015-07-06