Incidental Mutation 'R0010:Ahrr'
ID32505
Institutional Source Beutler Lab
Gene Symbol Ahrr
Ensembl Gene ENSMUSG00000021575
Gene Namearyl-hydrocarbon receptor repressor
Synonyms
MMRRC Submission 038305-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0010 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location74211118-74292331 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 74283024 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022059] [ENSMUST00000109640]
Predicted Effect probably benign
Transcript: ENSMUST00000022059
SMART Domains Protein: ENSMUSP00000022059
Gene: ENSMUSG00000021575

DomainStartEndE-ValueType
HLH 32 86 1.1e-11 SMART
PAS 108 174 6.6e-14 SMART
low complexity region 236 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109640
SMART Domains Protein: ENSMUSP00000105268
Gene: ENSMUSG00000021575

DomainStartEndE-ValueType
Blast:PAS 1 46 1e-27 BLAST
PDB:4M4X|B 1 142 2e-30 PDB
SCOP:d1jnua_ 2 63 7e-3 SMART
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: This gene encodes a protein that represses aryl hydrocarbon receptor-dependent signaling. The encoded protein competes with the aryl hydrocarbon receptor transcription factor for heterodimerization with the aryl hydrocarbon receptor nuclear translocator protein and binding to xenobiotic response element (XRE) sequence in many genes. This protein is implicated in the regulation of cell growth and differentiation as well as mediating dioxin toxicity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,205,609 probably benign Het
Bbs7 T C 3: 36,607,717 probably null Het
BC037034 T C 5: 138,260,293 probably null Het
Cacna1h T C 17: 25,380,844 K1566E probably damaging Het
Ccdc73 C T 2: 104,980,987 probably benign Het
Cd74 A T 18: 60,809,071 H124L probably benign Het
Cd74 A T 18: 60,803,896 probably benign Het
Cdk5rap2 T C 4: 70,243,459 E270G probably benign Het
Ces2a G A 8: 104,741,396 D520N probably benign Het
Cldnd1 T A 16: 58,731,259 probably benign Het
Cox17 T A 16: 38,347,170 C24S possibly damaging Het
Cyp2b9 T A 7: 26,186,753 probably benign Het
Dennd4a T C 9: 64,896,715 L1112P probably benign Het
Dennd4c T C 4: 86,781,577 S222P probably damaging Het
Dhx37 T A 5: 125,431,616 Q85L probably benign Het
Egfem1 G T 3: 29,582,919 C192F probably damaging Het
Eif3f A T 7: 108,941,005 N336Y possibly damaging Het
Evc2 T A 5: 37,417,449 L1016Q probably damaging Het
Fam114a2 G T 11: 57,514,156 T40N probably damaging Het
Fam135b T C 15: 71,622,032 K16R probably damaging Het
Fcho1 A G 8: 71,709,999 Y725H probably damaging Het
Frem1 T C 4: 83,000,098 I536V probably benign Het
Ginm1 T C 10: 7,775,374 probably benign Het
Glrb A T 3: 80,860,315 probably benign Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10320 T C 13: 98,489,546 Y110C probably damaging Het
Gm20388 G A 8: 122,270,598 probably benign Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm5422 A G 10: 31,249,754 noncoding transcript Het
Igkv6-29 A T 6: 70,138,770 probably benign Het
Inpp5d G A 1: 87,697,546 probably null Het
Itpr3 T G 17: 27,120,977 V2610G probably damaging Het
Kmt5c T A 7: 4,746,208 M88K probably benign Het
Lrp12 C T 15: 39,878,276 A367T probably damaging Het
Ltbp1 A G 17: 75,363,391 T1476A probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Milr1 T G 11: 106,767,003 *209G probably null Het
Mitf A G 6: 97,807,281 K33R probably benign Het
Mon2 A C 10: 123,032,694 S485A probably damaging Het
Mpdu1 C T 11: 69,658,841 G47R probably damaging Het
Ms4a4d A G 19: 11,554,826 N112S probably damaging Het
Mybpc3 G A 2: 91,134,833 W1082* probably null Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Naa15 A T 3: 51,436,213 probably null Het
Nav3 A G 10: 109,823,226 probably benign Het
Nek7 T A 1: 138,544,204 Q66L possibly damaging Het
Nktr G A 9: 121,741,166 probably benign Het
Nlgn1 G T 3: 25,435,842 probably benign Het
Npr1 T C 3: 90,454,832 E1002G probably damaging Het
Nup133 A T 8: 123,904,579 I1072N probably damaging Het
Oc90 C T 15: 65,876,548 C371Y probably damaging Het
Olfr835 A T 9: 19,035,322 L66F probably damaging Het
Olfr901 A T 9: 38,430,920 I213F possibly damaging Het
Olfr994 A T 2: 85,429,895 D311E probably benign Het
Pradc1 A T 6: 85,447,231 N44K probably damaging Het
Pradc1 T C 6: 85,447,620 D116G probably damaging Het
Ptprk G A 10: 28,585,969 C91Y probably damaging Het
Pus7 T C 5: 23,747,845 I491V probably benign Het
Rock1 T A 18: 10,084,380 D951V probably damaging Het
Scgb2b26 T A 7: 33,944,349 E55D probably damaging Het
Scn8a T C 15: 101,013,573 V958A probably damaging Het
Sec14l1 T C 11: 117,143,770 probably benign Het
Sec24c A G 14: 20,689,261 probably benign Het
Sema6b C T 17: 56,124,105 E853K probably benign Het
Sgk1 G A 10: 21,997,438 probably null Het
Shprh C T 10: 11,151,931 T94I probably benign Het
Slc16a3 T C 11: 120,956,705 S240P probably benign Het
Slc5a8 T C 10: 88,886,590 V95A probably benign Het
Smg1 A T 7: 118,171,859 probably benign Het
Spta1 G A 1: 174,217,943 V1556I probably benign Het
Svs1 A T 6: 48,988,906 H616L probably damaging Het
Trappc4 G A 9: 44,405,231 probably benign Het
Tubgcp6 A G 15: 89,103,183 S1188P probably benign Het
Txlna T G 4: 129,629,086 D487A probably benign Het
Ube2d2b T C 5: 107,830,636 F51S possibly damaging Het
Vmn2r6 G A 3: 64,559,545 Q178* probably null Het
Wdfy3 T C 5: 101,848,349 T3234A probably damaging Het
Ylpm1 C A 12: 85,029,026 Q384K probably damaging Het
Zbtb41 T G 1: 139,423,530 V127G probably damaging Het
Zfp605 T A 5: 110,127,534 C173S probably benign Het
Zfp608 A T 18: 54,895,214 probably benign Het
Zhx2 T C 15: 57,821,274 V13A possibly damaging Het
Other mutations in Ahrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Ahrr APN 13 74220573 missense possibly damaging 0.52
IGL03143:Ahrr APN 13 74257495 nonsense probably null
calico_jack UTSW 13 74222912 missense possibly damaging 0.51
R0009:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0040:Ahrr UTSW 13 74283024 splice site probably benign
R0079:Ahrr UTSW 13 74283024 splice site probably benign
R0082:Ahrr UTSW 13 74283024 splice site probably benign
R0164:Ahrr UTSW 13 74283024 splice site probably benign
R0165:Ahrr UTSW 13 74283024 splice site probably benign
R0167:Ahrr UTSW 13 74283024 splice site probably benign
R0310:Ahrr UTSW 13 74283024 splice site probably benign
R0344:Ahrr UTSW 13 74214586 missense probably damaging 1.00
R0948:Ahrr UTSW 13 74213769 missense probably damaging 1.00
R1192:Ahrr UTSW 13 74214403 missense probably benign 0.00
R1438:Ahrr UTSW 13 74224868 nonsense probably null
R1532:Ahrr UTSW 13 74213707 missense probably benign 0.01
R1600:Ahrr UTSW 13 74214378 missense probably benign 0.00
R2302:Ahrr UTSW 13 74277661 missense probably damaging 1.00
R3055:Ahrr UTSW 13 74224887 missense probably damaging 1.00
R4683:Ahrr UTSW 13 74224766 splice site silent
R4717:Ahrr UTSW 13 74215766 missense probably benign 0.03
R4769:Ahrr UTSW 13 74214212 missense probably damaging 1.00
R5998:Ahrr UTSW 13 74213836 missense probably damaging 0.99
R6225:Ahrr UTSW 13 74222912 missense possibly damaging 0.51
R7156:Ahrr UTSW 13 74229916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCACTTTCCACAGACAGAATGAC -3'
(R):5'- TGAGGGCCAATGGATCGTACTGAC -3'

Sequencing Primer
(F):5'- CCACAGACAGAATGACTTATTGCTG -3'
(R):5'- AATGGATCGTACTGACCTTCTTG -3'
Posted On2013-05-09