Incidental Mutation 'R4375:Prcc'
ID325060
Institutional Source Beutler Lab
Gene Symbol Prcc
Ensembl Gene ENSMUSG00000004895
Gene Namepapillary renal cell carcinoma (translocation-associated)
Synonyms
MMRRC Submission 041119-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R4375 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87858903-87885608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87867407 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 363 (Y363H)
Ref Sequence ENSEMBL: ENSMUSP00000005015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005015]
Predicted Effect probably damaging
Transcript: ENSMUST00000005015
AA Change: Y363H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005015
Gene: ENSMUSG00000004895
AA Change: Y363H

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
low complexity region 42 95 N/A INTRINSIC
low complexity region 101 136 N/A INTRINSIC
low complexity region 229 258 N/A INTRINSIC
Pfam:PRCC 275 490 7.2e-62 PFAM
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in pre-mRNA splicing. Chromosomal translocations (X;1)(p11;q21) that result in fusion of this gene to TFE3 (GeneID 7030) have been associated with papillary renal cell carcinoma. A PRCC-TFE3 fusion protein is expressed in affected carcinomas and is likely associated with altered gene transactivation. This fusion protein has also been associated with disruption of the cell cycle.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adhfe1 A T 1: 9,561,628 probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cntnap1 A G 11: 101,182,253 D561G probably damaging Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Cyp4b1 T C 4: 115,636,313 T191A probably benign Het
Dapk1 A T 13: 60,761,589 M1339L probably benign Het
Dpm3 T C 3: 89,266,908 Y59H probably damaging Het
Eif2ak4 A G 2: 118,427,924 Y585C probably damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Fam184b T C 5: 45,542,343 D577G probably benign Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hsf2bp C T 17: 31,987,348 D270N probably null Het
Lactbl1 T C 4: 136,637,591 V418A possibly damaging Het
Lifr A T 15: 7,166,898 M188L probably benign Het
Ltbp1 G T 17: 75,312,997 G760V probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr365 T A 2: 37,201,562 M107K probably benign Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr898 T C 9: 38,349,169 F23L probably benign Het
Pcdh17 T C 14: 84,448,271 V726A possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Phf20l1 T C 15: 66,615,222 S369P probably benign Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Proser3 A G 7: 30,540,671 V336A possibly damaging Het
Rbbp8 C T 18: 11,725,410 T646M probably benign Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snx9 G A 17: 5,908,626 W292* probably null Het
St14 T C 9: 31,090,458 I784V probably benign Het
Strc A G 2: 121,380,823 S14P unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ubap1 G A 4: 41,371,850 probably null Het
Zfr T C 15: 12,118,340 probably null Het
Other mutations in Prcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Prcc APN 3 87872208 critical splice donor site probably null
IGL01314:Prcc APN 3 87870080 missense probably damaging 0.99
IGL01511:Prcc APN 3 87872241 missense probably damaging 1.00
IGL02517:Prcc APN 3 87869677 missense probably damaging 1.00
R4376:Prcc UTSW 3 87867407 missense probably damaging 1.00
R4377:Prcc UTSW 3 87867407 missense probably damaging 1.00
R5015:Prcc UTSW 3 87872253 missense probably damaging 1.00
R6050:Prcc UTSW 3 87869884 missense probably damaging 0.99
R6259:Prcc UTSW 3 87862147 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGCTTAATCCCGAGCACAG -3'
(R):5'- CTGCCTGGATAGTACCCATG -3'

Sequencing Primer
(F):5'- TTGAACACAGTCCGTAGCTG -3'
(R):5'- CCATGAGGGAGCTGCAGG -3'
Posted On2015-07-06