Mutagenetix > Incidental Mutation

Incidental Mutation 'R4375:Cntnap1'

325075

Institutional Source

Beutler Lab

Gene Symbol

Cntnap1

Ensembl Gene

ENSMUSG00000017167

Gene Name

contactin associated protein-like 1

Synonyms

Nrxn4, NCP1, Caspr, paranodin, p190, shm

MMRRC Submission

041119-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.496) question?

Stock #

R4375 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101065429-101081550 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101073079 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 561 (D561G)

Ref Sequence

ENSEMBL: ENSMUSP00000099398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103109]

AlphaFold

O54991

Predicted Effect

probably damaging
Transcript: ENSMUST00000103109
AA Change: D561G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167
AA Change: D561G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
FA58C	25	169	7.49e-36	SMART
LamG	196	333	2.86e-32	SMART
LamG	382	516	3.49e-27	SMART
EGF	544	578	2.28e0	SMART
Blast:FBG	580	777	1e-133	BLAST
LamG	806	940	1.95e-25	SMART
EGF_like	961	997	6.03e1	SMART
low complexity region	1032	1044	N/A	INTRINSIC
low complexity region	1047	1058	N/A	INTRINSIC
low complexity region	1063	1078	N/A	INTRINSIC
LamG	1081	1219	2.59e-30	SMART
4.1m	1305	1323	7.85e-7	SMART
low complexity region	1333	1370	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138942

Meta Mutation Damage Score

0.4124

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adhfe1	A	T	1: 9,631,853 (GRCm39)		probably benign	Het
Cd209c	T	C	8: 4,004,635 (GRCm39)		noncoding transcript	Het
Csf1	T	A	3: 107,664,055 (GRCm39)	T38S	probably damaging	Het
Cyp4b1	T	C	4: 115,493,510 (GRCm39)	T191A	probably benign	Het
Dapk1	A	T	13: 60,909,403 (GRCm39)	M1339L	probably benign	Het
Dpm3	T	C	3: 89,174,215 (GRCm39)	Y59H	probably damaging	Het
Eif2ak4	A	G	2: 118,258,405 (GRCm39)	Y585C	probably damaging	Het
Ercc1	G	A	7: 19,081,057 (GRCm39)		probably benign	Het
Fam184b	T	C	5: 45,699,685 (GRCm39)	D577G	probably benign	Het
Gon4l	C	A	3: 88,814,694 (GRCm39)	P1888T	probably benign	Het
Hsf2bp	C	T	17: 32,206,322 (GRCm39)	D270N	probably null	Het
Lactbl1	T	C	4: 136,364,902 (GRCm39)	V418A	possibly damaging	Het
Lifr	A	T	15: 7,196,379 (GRCm39)	M188L	probably benign	Het
Ltbp1	G	T	17: 75,619,992 (GRCm39)	G760V	probably damaging	Het
Marchf11	A	G	15: 26,309,532 (GRCm39)	E62G	probably damaging	Het
Nlrp12	A	G	7: 3,289,576 (GRCm39)	L312P	possibly damaging	Het
Or1l4	T	A	2: 37,091,574 (GRCm39)	M107K	probably benign	Het
Or52ae7	T	C	7: 103,119,278 (GRCm39)	S11P	probably damaging	Het
Or8c20	T	C	9: 38,260,465 (GRCm39)	F23L	probably benign	Het
Pcdh17	T	C	14: 84,685,711 (GRCm39)	V726A	possibly damaging	Het
Pdia4	G	A	6: 47,775,326 (GRCm39)	R495W	probably damaging	Het
Phf20l1	T	C	15: 66,487,071 (GRCm39)	S369P	probably benign	Het
Polq	G	T	16: 36,833,543 (GRCm39)	V79F	probably damaging	Het
Prcc	A	G	3: 87,774,714 (GRCm39)	Y363H	probably damaging	Het
Proser3	A	G	7: 30,240,096 (GRCm39)	V336A	possibly damaging	Het
Rbbp8	C	T	18: 11,858,467 (GRCm39)	T646M	probably benign	Het
Rgs1	T	C	1: 144,123,644 (GRCm39)	T94A	probably benign	Het
Rpl11	G	A	4: 135,778,454 (GRCm39)		probably benign	Het
Slc14a2	G	A	18: 78,250,283 (GRCm39)	R62C	probably damaging	Het
Snx9	G	A	17: 5,958,901 (GRCm39)	W292*	probably null	Het
St14	T	C	9: 31,001,754 (GRCm39)	I784V	probably benign	Het
Steep1	C	A	X: 36,087,812 (GRCm39)	C206F	probably benign	Het
Strc	A	G	2: 121,211,304 (GRCm39)	S14P	unknown	Het
Ttc23l	CT	CTTGGATT	15: 10,537,648 (GRCm39)		probably benign	Het
Ttc23l	G	A	15: 10,537,652 (GRCm39)	S206L	probably benign	Het
Ubap1	G	A	4: 41,371,850 (GRCm39)		probably null	Het
Zfr	T	C	15: 12,118,426 (GRCm39)		probably null	Het

Other mutations in Cntnap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Cntnap1	APN	11	101,075,918 (GRCm39)	missense	possibly damaging	0.63
IGL00715:Cntnap1	APN	11	101,074,031 (GRCm39)	splice site	probably benign
IGL00792:Cntnap1	APN	11	101,069,792 (GRCm39)	missense	probably benign	0.19
IGL01063:Cntnap1	APN	11	101,072,614 (GRCm39)	missense	probably benign	0.00
IGL01141:Cntnap1	APN	11	101,069,633 (GRCm39)	splice site	probably benign
IGL02184:Cntnap1	APN	11	101,069,191 (GRCm39)	missense	probably damaging	0.98
IGL02272:Cntnap1	APN	11	101,069,142 (GRCm39)	missense	probably damaging	0.99
IGL02281:Cntnap1	APN	11	101,073,080 (GRCm39)	missense	possibly damaging	0.86
IGL02437:Cntnap1	APN	11	101,077,677 (GRCm39)	missense	probably damaging	1.00
IGL02456:Cntnap1	APN	11	101,068,955 (GRCm39)	missense	probably benign	0.31
IGL02966:Cntnap1	APN	11	101,075,575 (GRCm39)	missense	probably damaging	1.00
IGL03126:Cntnap1	APN	11	101,067,127 (GRCm39)	missense	probably benign	0.00
IGL03294:Cntnap1	APN	11	101,072,508 (GRCm39)	missense	possibly damaging	0.94
Penny	UTSW	11	101,077,590 (GRCm39)	missense	probably damaging	0.99
FR4304:Cntnap1	UTSW	11	101,080,415 (GRCm39)	unclassified	probably benign
FR4304:Cntnap1	UTSW	11	101,080,407 (GRCm39)	unclassified	probably benign
FR4342:Cntnap1	UTSW	11	101,080,401 (GRCm39)	unclassified	probably benign
FR4449:Cntnap1	UTSW	11	101,080,419 (GRCm39)	unclassified	probably benign
FR4449:Cntnap1	UTSW	11	101,080,395 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,419 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,405 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,398 (GRCm39)	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101,080,420 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,401 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,392 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,407 (GRCm39)	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101,080,406 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,416 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,395 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,402 (GRCm39)	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101,080,408 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,414 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,395 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,398 (GRCm39)	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101,080,411 (GRCm39)	unclassified	probably benign
PIT4354001:Cntnap1	UTSW	11	101,072,123 (GRCm39)	missense	probably damaging	1.00
PIT4466001:Cntnap1	UTSW	11	101,068,131 (GRCm39)	missense	probably benign
R0329:Cntnap1	UTSW	11	101,079,135 (GRCm39)	missense	probably damaging	1.00
R0556:Cntnap1	UTSW	11	101,074,822 (GRCm39)	missense	probably benign
R0586:Cntnap1	UTSW	11	101,077,840 (GRCm39)	missense	probably damaging	0.97
R0635:Cntnap1	UTSW	11	101,074,285 (GRCm39)	missense	probably benign	0.05
R0789:Cntnap1	UTSW	11	101,072,210 (GRCm39)	splice site	probably benign
R1016:Cntnap1	UTSW	11	101,068,333 (GRCm39)	missense	probably damaging	0.99
R1085:Cntnap1	UTSW	11	101,069,662 (GRCm39)	missense	probably benign	0.02
R1211:Cntnap1	UTSW	11	101,075,536 (GRCm39)	missense	probably damaging	1.00
R1466:Cntnap1	UTSW	11	101,071,186 (GRCm39)	missense	probably damaging	1.00
R1466:Cntnap1	UTSW	11	101,071,186 (GRCm39)	missense	probably damaging	1.00
R1584:Cntnap1	UTSW	11	101,071,186 (GRCm39)	missense	probably damaging	1.00
R1689:Cntnap1	UTSW	11	101,079,699 (GRCm39)	splice site	probably null
R1758:Cntnap1	UTSW	11	101,075,449 (GRCm39)	missense	probably damaging	1.00
R1779:Cntnap1	UTSW	11	101,077,337 (GRCm39)	missense	probably damaging	0.99
R1964:Cntnap1	UTSW	11	101,068,850 (GRCm39)	nonsense	probably null
R1966:Cntnap1	UTSW	11	101,071,212 (GRCm39)	missense	possibly damaging	0.89
R2070:Cntnap1	UTSW	11	101,073,805 (GRCm39)	missense	probably damaging	1.00
R2088:Cntnap1	UTSW	11	101,073,373 (GRCm39)	missense	probably damaging	1.00
R2118:Cntnap1	UTSW	11	101,079,483 (GRCm39)	missense	probably benign
R3795:Cntnap1	UTSW	11	101,077,590 (GRCm39)	missense	probably damaging	0.99
R4779:Cntnap1	UTSW	11	101,068,898 (GRCm39)	missense	possibly damaging	0.91
R4832:Cntnap1	UTSW	11	101,073,845 (GRCm39)	missense	probably damaging	1.00
R4965:Cntnap1	UTSW	11	101,068,251 (GRCm39)	missense	possibly damaging	0.52
R4981:Cntnap1	UTSW	11	101,067,159 (GRCm39)	splice site	probably null
R5008:Cntnap1	UTSW	11	101,079,567 (GRCm39)	nonsense	probably null
R5399:Cntnap1	UTSW	11	101,074,142 (GRCm39)	missense	probably benign
R5507:Cntnap1	UTSW	11	101,074,303 (GRCm39)	missense	probably benign	0.42
R5560:Cntnap1	UTSW	11	101,073,261 (GRCm39)	missense	probably damaging	1.00
R5589:Cntnap1	UTSW	11	101,075,944 (GRCm39)	missense	probably benign
R6038:Cntnap1	UTSW	11	101,075,462 (GRCm39)	missense	probably benign	0.12
R6038:Cntnap1	UTSW	11	101,075,462 (GRCm39)	missense	probably benign	0.12
R6242:Cntnap1	UTSW	11	101,073,364 (GRCm39)	missense	probably damaging	1.00
R6306:Cntnap1	UTSW	11	101,075,441 (GRCm39)	missense	probably damaging	1.00
R6392:Cntnap1	UTSW	11	101,077,472 (GRCm39)	missense	probably damaging	1.00
R6803:Cntnap1	UTSW	11	101,068,060 (GRCm39)	missense	possibly damaging	0.81
R6939:Cntnap1	UTSW	11	101,077,337 (GRCm39)	missense	probably damaging	0.99
R6944:Cntnap1	UTSW	11	101,073,730 (GRCm39)	missense	probably damaging	0.97
R7152:Cntnap1	UTSW	11	101,068,152 (GRCm39)	missense	probably damaging	1.00
R7297:Cntnap1	UTSW	11	101,079,460 (GRCm39)	missense	probably benign	0.01
R7347:Cntnap1	UTSW	11	101,076,094 (GRCm39)	missense	probably damaging	1.00
R7961:Cntnap1	UTSW	11	101,069,121 (GRCm39)	missense	probably benign
R7980:Cntnap1	UTSW	11	101,079,719 (GRCm39)	missense	probably benign
R8307:Cntnap1	UTSW	11	101,079,702 (GRCm39)	missense	possibly damaging	0.73
R8386:Cntnap1	UTSW	11	101,073,029 (GRCm39)	missense	probably damaging	1.00
R8403:Cntnap1	UTSW	11	101,068,416 (GRCm39)	missense	probably damaging	1.00
R8826:Cntnap1	UTSW	11	101,077,655 (GRCm39)	missense	probably damaging	0.99
R9103:Cntnap1	UTSW	11	101,072,094 (GRCm39)	missense	probably benign	0.06
R9279:Cntnap1	UTSW	11	101,072,121 (GRCm39)	missense	probably damaging	0.99
R9284:Cntnap1	UTSW	11	101,068,137 (GRCm39)	missense	probably benign
R9386:Cntnap1	UTSW	11	101,076,052 (GRCm39)	missense	probably damaging	1.00
R9689:Cntnap1	UTSW	11	101,072,178 (GRCm39)	missense	probably damaging	0.98
R9697:Cntnap1	UTSW	11	101,068,828 (GRCm39)	missense	possibly damaging	0.51
RF042:Cntnap1	UTSW	11	101,071,131 (GRCm39)	critical splice acceptor site	probably benign
RF048:Cntnap1	UTSW	11	101,080,389 (GRCm39)	unclassified	probably benign
RF048:Cntnap1	UTSW	11	101,071,131 (GRCm39)	critical splice acceptor site	probably benign
RF049:Cntnap1	UTSW	11	101,080,422 (GRCm39)	unclassified	probably benign
RF049:Cntnap1	UTSW	11	101,080,418 (GRCm39)	unclassified	probably benign
RF050:Cntnap1	UTSW	11	101,080,418 (GRCm39)	unclassified	probably benign
Z1176:Cntnap1	UTSW	11	101,073,724 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTGGCACGAAGAGGACCG -3'
(R):5'- CCTTGTACAATGCTAGTGGGG -3'

Sequencing Primer
(F):5'- GACCGCACTTGATCCCTGTAGAC -3'
(R):5'- AATGCTAGTGGGGGCGGC -3'

Posted On

2015-07-06