Incidental Mutation 'R4376:Prcc'
ID325091
Institutional Source Beutler Lab
Gene Symbol Prcc
Ensembl Gene ENSMUSG00000004895
Gene Namepapillary renal cell carcinoma (translocation-associated)
Synonyms
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87858903-87885608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87867407 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 363 (Y363H)
Ref Sequence ENSEMBL: ENSMUSP00000005015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005015]
Predicted Effect probably damaging
Transcript: ENSMUST00000005015
AA Change: Y363H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005015
Gene: ENSMUSG00000004895
AA Change: Y363H

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
low complexity region 42 95 N/A INTRINSIC
low complexity region 101 136 N/A INTRINSIC
low complexity region 229 258 N/A INTRINSIC
Pfam:PRCC 275 490 7.2e-62 PFAM
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in pre-mRNA splicing. Chromosomal translocations (X;1)(p11;q21) that result in fusion of this gene to TFE3 (GeneID 7030) have been associated with papillary renal cell carcinoma. A PRCC-TFE3 fusion protein is expressed in affected carcinomas and is likely associated with altered gene transactivation. This fusion protein has also been associated with disruption of the cell cycle.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Prcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Prcc APN 3 87872208 critical splice donor site probably null
IGL01314:Prcc APN 3 87870080 missense probably damaging 0.99
IGL01511:Prcc APN 3 87872241 missense probably damaging 1.00
IGL02517:Prcc APN 3 87869677 missense probably damaging 1.00
R4375:Prcc UTSW 3 87867407 missense probably damaging 1.00
R4377:Prcc UTSW 3 87867407 missense probably damaging 1.00
R5015:Prcc UTSW 3 87872253 missense probably damaging 1.00
R6050:Prcc UTSW 3 87869884 missense probably damaging 0.99
R6259:Prcc UTSW 3 87862147 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGCTTAATCCCGAGCACAG -3'
(R):5'- TCTGCCTGGATAGTACCCATG -3'

Sequencing Primer
(F):5'- TTGAACACAGTCCGTAGCTG -3'
(R):5'- CCATGAGGGAGCTGCAGG -3'
Posted On2015-07-06