Incidental Mutation 'R4377:Frmd3'
ID325133
Institutional Source Beutler Lab
Gene Symbol Frmd3
Ensembl Gene ENSMUSG00000049122
Gene NameFERM domain containing 3
Synonyms4.1O, EPB41L4O, P410, 9430066I12Rik
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location74013442-74202214 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to A at 74128298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084474] [ENSMUST00000098006]
Predicted Effect probably null
Transcript: ENSMUST00000084474
SMART Domains Protein: ENSMUSP00000081514
Gene: ENSMUSG00000049122

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098006
SMART Domains Protein: ENSMUSP00000095615
Gene: ENSMUSG00000049122

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I519T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Frmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Frmd3 APN 4 74074120 missense possibly damaging 0.62
IGL01774:Frmd3 APN 4 74187838 missense probably damaging 1.00
IGL02213:Frmd3 APN 4 74135872 missense probably benign 0.36
IGL02479:Frmd3 APN 4 74187515 missense probably benign 0.30
IGL03248:Frmd3 APN 4 74128218 missense possibly damaging 0.71
R0765:Frmd3 UTSW 4 74161767 missense probably damaging 1.00
R1411:Frmd3 UTSW 4 74153621 missense probably damaging 1.00
R1535:Frmd3 UTSW 4 74013758 start gained probably benign
R1990:Frmd3 UTSW 4 74187439 missense probably damaging 1.00
R3898:Frmd3 UTSW 4 74074109 missense probably damaging 1.00
R4616:Frmd3 UTSW 4 74187872 missense probably benign 0.15
R4965:Frmd3 UTSW 4 74153600 missense probably damaging 1.00
R5024:Frmd3 UTSW 4 74098144 missense probably benign 0.00
R5104:Frmd3 UTSW 4 74145078 missense probably damaging 1.00
R5418:Frmd3 UTSW 4 74161698 critical splice acceptor site probably null
R5434:Frmd3 UTSW 4 74187796 missense probably damaging 1.00
R5878:Frmd3 UTSW 4 74153610 missense probably damaging 1.00
R5999:Frmd3 UTSW 4 74170691 missense possibly damaging 0.49
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6616:Frmd3 UTSW 4 74187488 missense probably damaging 0.97
R6813:Frmd3 UTSW 4 74159245 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTGCATTGAACTAGGCATGAC -3'
(R):5'- AGAGCTTAACCATCTGCCAG -3'

Sequencing Primer
(F):5'- GAACTAGGCATGACATTAGTGGTTC -3'
(R):5'- CTTAACCATCTGCCAGGAAGAGTG -3'
Posted OnJul 06, 2015