Incidental Mutation 'R4377:Rpl11'
ID325134
Institutional Source Beutler Lab
Gene Symbol Rpl11
Ensembl Gene ENSMUSG00000059291
Gene Nameribosomal protein L11
Synonyms
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4377 (G1)
Quality Score174
Status Validated
Chromosome4
Chromosomal Location136028265-136053428 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 136051143 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102536] [ENSMUST00000155873]
Predicted Effect probably benign
Transcript: ENSMUST00000102536
SMART Domains Protein: ENSMUSP00000099595
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 63 6.9e-23 PFAM
Pfam:Ribosomal_L5_C 67 166 9.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150565
Predicted Effect probably benign
Transcript: ENSMUST00000155873
SMART Domains Protein: ENSMUSP00000121108
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 13 66 8e-23 PFAM
Pfam:Ribosomal_L5_C 70 169 1.1e-26 PFAM
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I519T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Rpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4373:Rpl11 UTSW 4 136051143 intron probably benign
R4374:Rpl11 UTSW 4 136051143 intron probably benign
R4375:Rpl11 UTSW 4 136051143 intron probably benign
R4560:Rpl11 UTSW 4 136051211 missense probably damaging 1.00
R4781:Rpl11 UTSW 4 136050288 missense probably benign 0.00
R5541:Rpl11 UTSW 4 136052732 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ATTCGAAGGGCAAATGCAGC -3'
(R):5'- ATGATGGATAGCATGGTCACTTC -3'

Sequencing Primer
(F):5'- CCAGGATGACCCAGAGAGCTTTG -3'
(R):5'- ATAGCATGGTCACTTCTGTGTC -3'
Posted OnJul 06, 2015