Incidental Mutation 'R4377:Kit'
ID325138
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75640499 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 519 (I519T)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure
Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: I519T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: I519T

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136002
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: I515T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: I515T

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151357
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably benign Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably benign Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably benign Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably benign 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably benign
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGTTCTAGTCCTAGCAC -3'
(R):5'- TGTGTCACCCGCTGAACAATC -3'

Sequencing Primer
(F):5'- TCCTAGCACCAAGAATAAATGTAGG -3'
(R):5'- GAACAATCAGTGCCTGCCCTG -3'
Posted OnJul 06, 2015