Incidental Mutation 'R4377:Mvk'
ID325141
Institutional Source Beutler Lab
Gene Symbol Mvk
Ensembl Gene ENSMUSG00000041939
Gene Namemevalonate kinase
Synonyms2310010A05Rik
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114444269-114460591 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 114452961 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043760] [ENSMUST00000112239] [ENSMUST00000124260] [ENSMUST00000125650] [ENSMUST00000137167] [ENSMUST00000139420]
Predicted Effect probably benign
Transcript: ENSMUST00000043760
SMART Domains Protein: ENSMUSP00000036971
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 108 118 N/A INTRINSIC
Pfam:GHMP_kinases_N 130 212 7.6e-26 PFAM
Pfam:GHMP_kinases_C 291 365 2.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112239
SMART Domains Protein: ENSMUSP00000107858
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 1.6e-25 PFAM
Pfam:GHMP_kinases_C 303 377 8.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124260
SMART Domains Protein: ENSMUSP00000143347
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 5.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125120
Predicted Effect probably benign
Transcript: ENSMUST00000125650
SMART Domains Protein: ENSMUSP00000114611
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137167
SMART Domains Protein: ENSMUSP00000142758
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 108 118 N/A INTRINSIC
Pfam:GHMP_kinases_N 130 212 5.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139420
SMART Domains Protein: ENSMUSP00000142376
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
PDB:2R42|A 1 62 6e-30 PDB
SCOP:d1kvka1 2 31 1e-10 SMART
Meta Mutation Damage Score 0.0452 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes mevalonate kinase, a key enzyme involved in the biosynthesis of cholesterol and non-sterol isoprenes. The complete lack of encoded protein is lethal to mouse embryos. Mice lacking one allele of this gene exhibit increased levels of mevalonate in spleen, heart and kidney, as well as increased levels of serum immunoglobulins A and D. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C107Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Mvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mvk APN 5 114445441 missense probably benign 0.00
IGL01615:Mvk APN 5 114446292 missense probably benign 0.41
IGL02735:Mvk APN 5 114450819 missense probably benign 0.00
R0206:Mvk UTSW 5 114458974 missense probably damaging 1.00
R1474:Mvk UTSW 5 114460096 missense probably damaging 0.99
R2511:Mvk UTSW 5 114450398 nonsense probably null
R4861:Mvk UTSW 5 114460197 intron probably benign
R4902:Mvk UTSW 5 114455999 missense probably benign 0.05
R5073:Mvk UTSW 5 114452952 intron probably benign
R5355:Mvk UTSW 5 114452438 missense probably damaging 1.00
R5411:Mvk UTSW 5 114458973 missense probably benign 0.00
R5637:Mvk UTSW 5 114455942 missense possibly damaging 0.47
R5687:Mvk UTSW 5 114450765 missense probably damaging 1.00
R6778:Mvk UTSW 5 114452380 missense probably benign 0.01
Z1088:Mvk UTSW 5 114458934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAGCCTGGCATGTCCTG -3'
(R):5'- GAAACAGCCTGAGACGTATGTC -3'

Sequencing Primer
(F):5'- GATGGCTACTGTCTCTCT -3'
(R):5'- GACGTATGTCTACATTCCCGGG -3'
Posted On2015-07-06