Incidental Mutation 'R4377:Olfr965'
ID325153
Institutional Source Beutler Lab
Gene Symbol Olfr965
Ensembl Gene ENSMUSG00000095839
Gene Nameolfactory receptor 965
SynonymsGA_x6K02T2PVTD-33416730-33417668, MOR171-28
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39711353-39720614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39719807 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 193 (F193L)
Ref Sequence ENSEMBL: ENSMUSP00000150401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342] [ENSMUST00000213335] [ENSMUST00000215164]
Predicted Effect probably benign
Transcript: ENSMUST00000069342
AA Change: F193L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: F193L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213335
AA Change: F193L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214875
Predicted Effect probably benign
Transcript: ENSMUST00000215164
AA Change: F193L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C107Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Olfr965
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Olfr965 APN 9 39719581 missense possibly damaging 0.95
IGL02365:Olfr965 APN 9 39719674 missense possibly damaging 0.60
IGL02365:Olfr965 APN 9 39720100 missense probably damaging 0.98
IGL03062:Olfr965 APN 9 39720035 missense probably benign 0.26
IGL03330:Olfr965 APN 9 39719488 missense probably benign 0.08
R0011:Olfr965 UTSW 9 39719627 missense probably benign 0.26
R0462:Olfr965 UTSW 9 39719410 missense probably benign 0.01
R1505:Olfr965 UTSW 9 39719478 missense probably damaging 1.00
R1995:Olfr965 UTSW 9 39719413 missense probably damaging 1.00
R2049:Olfr965 UTSW 9 39720115 missense probably damaging 1.00
R2110:Olfr965 UTSW 9 39719722 missense probably benign 0.30
R3817:Olfr965 UTSW 9 39720108 missense possibly damaging 0.95
R4152:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4153:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4351:Olfr965 UTSW 9 39719569 missense probably damaging 0.99
R4667:Olfr965 UTSW 9 39719709 missense probably benign 0.09
R5526:Olfr965 UTSW 9 39719596 missense possibly damaging 0.95
R5816:Olfr965 UTSW 9 39719230 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCACCATGTCTTACCAAGTC -3'
(R):5'- TCGGAGCTAACTGATGATGGC -3'

Sequencing Primer
(F):5'- ACCAAGTCTGTTTATGGATGATAGG -3'
(R):5'- TGGCTGAAAGTACATGAATCCC -3'
Posted On2015-07-06