Incidental Mutation 'R4377:Rad54l2'
ID325154
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene NameRAD54 like 2 (S. cerevisiae)
SynonymsSrisnf2l, G630026H09Rik, Arip4
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106688082-106789194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106693222 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1300 (S1300P)
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
Predicted Effect probably benign
Transcript: ENSMUST00000046502
AA Change: S1300P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: S1300P

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189553
AA Change: S28P
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C107Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106719606 critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106693717 unclassified probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106717795 missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106705858 missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGCGCAAACATCCTGG -3'
(R):5'- AGTTCCCTCTTGGTGACTGG -3'

Sequencing Primer
(F):5'- AAACATCCTGGGCTCGGACAG -3'
(R):5'- TCTTGGTGACTGGCCAGC -3'
Posted On2015-07-06