Incidental Mutation 'R4377:Osbpl8'
ID325156
Institutional Source Beutler Lab
Gene Symbol Osbpl8
Ensembl Gene ENSMUSG00000020189
Gene Nameoxysterol binding protein-like 8
SynonymsD330025H14Rik, ORP-8
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111164802-111297247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111269419 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 245 (I245N)
Ref Sequence ENSEMBL: ENSMUSP00000092948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095310] [ENSMUST00000105275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095310
AA Change: I203N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092948
Gene: ENSMUSG00000020189
AA Change: I203N

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
coiled coil region 71 102 N/A INTRINSIC
PH 107 225 3.65e-16 SMART
Pfam:Oxysterol_BP 364 715 6.4e-91 PFAM
coiled coil region 789 811 N/A INTRINSIC
transmembrane domain 829 846 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105275
AA Change: I245N

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189
AA Change: I245N

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 noncoding transcript Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 E6G probably damaging Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I519T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 T288A noncoding transcript Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M1006K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 noncoding transcript Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Osbpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Osbpl8 APN 10 111273044 missense probably benign 0.30
IGL00826:Osbpl8 APN 10 111272320 unclassified probably benign
IGL00839:Osbpl8 APN 10 111291510 missense probably benign 0.00
IGL01148:Osbpl8 APN 10 111276563 unclassified probably benign
IGL01338:Osbpl8 APN 10 111267747 missense probably damaging 0.99
IGL01927:Osbpl8 APN 10 111270616 missense probably benign 0.00
IGL02378:Osbpl8 APN 10 111282145 missense possibly damaging 0.94
IGL02863:Osbpl8 APN 10 111284425 unclassified probably benign
IGL02933:Osbpl8 APN 10 111282130 missense probably damaging 1.00
IGL03075:Osbpl8 APN 10 111291556 missense probably benign 0.01
R0388:Osbpl8 UTSW 10 111272282 missense probably benign
R0725:Osbpl8 UTSW 10 111286240 missense possibly damaging 0.64
R1353:Osbpl8 UTSW 10 111276479 missense probably damaging 0.97
R1434:Osbpl8 UTSW 10 111291581 missense probably benign 0.01
R1803:Osbpl8 UTSW 10 111275049 missense probably damaging 1.00
R1939:Osbpl8 UTSW 10 111289811 missense probably benign 0.19
R2847:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2848:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2849:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2879:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2935:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R3693:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R4088:Osbpl8 UTSW 10 111289790 missense possibly damaging 0.52
R4374:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4376:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4621:Osbpl8 UTSW 10 111269418 missense probably benign 0.01
R4622:Osbpl8 UTSW 10 111291496 missense probably benign 0.01
R4851:Osbpl8 UTSW 10 111204800 start codon destroyed probably null 0.00
R5134:Osbpl8 UTSW 10 111288693 missense probably benign 0.23
R5179:Osbpl8 UTSW 10 111272164 missense probably benign 0.02
R5309:Osbpl8 UTSW 10 111270557 missense probably benign 0.00
R5590:Osbpl8 UTSW 10 111272168 missense probably damaging 0.98
R5783:Osbpl8 UTSW 10 111267783 nonsense probably null
R6293:Osbpl8 UTSW 10 111272238 missense probably damaging 0.97
R6362:Osbpl8 UTSW 10 111273068 nonsense probably null
R6527:Osbpl8 UTSW 10 111293205 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCTTGGTATGGTACTGATTACTTGC -3'
(R):5'- GCAAAGCTAGTAATGTGCTCAATG -3'

Sequencing Primer
(F):5'- GTTGGGAAAGACTTTAATAAACAGC -3'
(R):5'- GCTAGTAATGTGCTCAATGTTCTAC -3'
Posted OnJul 06, 2015