Incidental Mutation 'R4377:Krt33a'
ID325157
Institutional Source Beutler Lab
Gene Symbol Krt33a
Ensembl Gene ENSMUSG00000035592
Gene Namekeratin 33A
Synonyms2310015J09Rik
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100011195-100016212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100012427 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 263 (E263G)
Ref Sequence ENSEMBL: ENSMUSP00000018399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018399]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018399
AA Change: E263G

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018399
Gene: ENSMUSG00000035592
AA Change: E263G

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 1.99e-148 SMART
internal_repeat_1 368 385 6.11e-5 PROSPERO
internal_repeat_1 384 399 6.11e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138756
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mutations of this gene cause the hair coat to appear either shiny, reflective and "polished" or greasy looking, disheveled and "spikey." [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I519T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Krt33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Krt33a APN 11 100012017 missense probably benign 0.35
IGL02412:Krt33a APN 11 100011979 missense probably benign 0.01
IGL02523:Krt33a APN 11 100011692 missense probably benign 0.02
Polished UTSW 11 100012611 missense probably damaging 1.00
Polished2 UTSW 11 100015850 missense probably benign 0.15
Spikey UTSW 11 100011939 missense probably damaging 1.00
R0492:Krt33a UTSW 11 100016083 missense probably benign 0.02
R0496:Krt33a UTSW 11 100012329 splice site probably benign
R0691:Krt33a UTSW 11 100012715 missense probably damaging 1.00
R1077:Krt33a UTSW 11 100015937 missense probably benign
R1624:Krt33a UTSW 11 100014246 missense probably damaging 1.00
R1911:Krt33a UTSW 11 100012349 missense probably benign 0.35
R1944:Krt33a UTSW 11 100012709 missense probably benign 0.10
R1945:Krt33a UTSW 11 100012709 missense probably benign 0.10
R2254:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R2255:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R3716:Krt33a UTSW 11 100014165 missense probably benign 0.01
R5233:Krt33a UTSW 11 100014135 missense probably damaging 1.00
R6029:Krt33a UTSW 11 100012463 missense probably benign 0.01
R6316:Krt33a UTSW 11 100014201 missense probably damaging 0.98
R6807:Krt33a UTSW 11 100012383 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCAGAGAAGTCACAGGCTTC -3'
(R):5'- GTACTCAACGAGACCAGGTG -3'

Sequencing Primer
(F):5'- AGAAGTCACAGGCTTCAAGAG -3'
(R):5'- ACCAGGTGTCAGTACGAGGC -3'
Posted OnJul 06, 2015