Incidental Mutation 'R4377:Zmiz1'
ID325163
Institutional Source Beutler Lab
Gene Symbol Zmiz1
Ensembl Gene ENSMUSG00000007817
Gene Namezinc finger, MIZ-type containing 1
SynonymsRai17, Zimp10
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location25459185-25666743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25636010 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 140 (S140P)
Ref Sequence ENSEMBL: ENSMUSP00000124820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007961] [ENSMUST00000162645]
Predicted Effect probably damaging
Transcript: ENSMUST00000007961
AA Change: S140P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007961
Gene: ENSMUSG00000007817
AA Change: S140P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 323 1e-3 SMART
low complexity region 431 446 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 498 505 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Pfam:zf-Nse 731 786 3.5e-8 PFAM
Pfam:zf-MIZ 739 788 7.6e-26 PFAM
low complexity region 867 881 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
low complexity region 1039 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160190
Predicted Effect probably damaging
Transcript: ENSMUST00000160229
AA Change: S16P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124820
Gene: ENSMUSG00000007817
AA Change: S16P

DomainStartEndE-ValueType
low complexity region 59 77 N/A INTRINSIC
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162645
AA Change: S140P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124863
Gene: ENSMUSG00000007817
AA Change: S140P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 309 2e-3 SMART
low complexity region 437 452 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 504 511 N/A INTRINSIC
low complexity region 517 532 N/A INTRINSIC
Pfam:zf-MIZ 745 794 2.1e-26 PFAM
low complexity region 873 887 N/A INTRINSIC
low complexity region 988 1003 N/A INTRINSIC
low complexity region 1045 1068 N/A INTRINSIC
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with failure of yolk sac vascular remodeling and abnormal embryonic vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 noncoding transcript Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 E6G probably damaging Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I519T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 T288A noncoding transcript Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M1006K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 noncoding transcript Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Other mutations in Zmiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Zmiz1 APN 14 25572070 missense probably null 0.66
IGL01582:Zmiz1 APN 14 25658230 missense probably benign 0.00
IGL01601:Zmiz1 APN 14 25581644 missense possibly damaging 0.78
IGL02008:Zmiz1 APN 14 25656879 missense probably damaging 0.97
IGL02395:Zmiz1 APN 14 25656763 missense probably damaging 1.00
IGL02836:Zmiz1 APN 14 25656742 unclassified noncoding transcript
zapp UTSW 14 25662980 missense unknown
R0144:Zmiz1 UTSW 14 25655247 missense probably damaging 1.00
R0255:Zmiz1 UTSW 14 25654495 splice site noncoding transcript
R1006:Zmiz1 UTSW 14 25662980 missense unknown
R1160:Zmiz1 UTSW 14 25654512 missense probably damaging 1.00
R1222:Zmiz1 UTSW 14 25658096 splice site noncoding transcript
R2846:Zmiz1 UTSW 14 25645675 missense probably benign 0.03
R4126:Zmiz1 UTSW 14 25656930 missense possibly damaging 0.94
R4373:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4374:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4533:Zmiz1 UTSW 14 25645660 missense probably damaging 1.00
R4726:Zmiz1 UTSW 14 25643674 critical splice donor site probably null
R5295:Zmiz1 UTSW 14 25656347 missense probably damaging 1.00
R5385:Zmiz1 UTSW 14 25649813 missense probably damaging 1.00
R5579:Zmiz1 UTSW 14 25644856 missense probably damaging 0.96
R5761:Zmiz1 UTSW 14 25651304 missense possibly damaging 0.86
R5761:Zmiz1 UTSW 14 25651306 missense probably damaging 1.00
R5844:Zmiz1 UTSW 14 25656930 missense probably damaging 1.00
R5875:Zmiz1 UTSW 14 25635966 missense probably null 0.93
R6051:Zmiz1 UTSW 14 25572070 start codon destroyed probably null 0.66
X0023:Zmiz1 UTSW 14 25649684 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGTGTCCACTGACCATCTGTC -3'
(R):5'- CTTTGGTTAGAGGGAAGGCTCC -3'

Sequencing Primer
(F):5'- GACCATCTGTCTTTGCTTGCAG -3'
(R):5'- GGGAAGGCTCCAAACTCATGATTC -3'
Posted OnJul 06, 2015