Incidental Mutation 'R4377:Arhgap22'
ID325164
Institutional Source Beutler Lab
Gene Symbol Arhgap22
Ensembl Gene ENSMUSG00000063506
Gene NameRho GTPase activating protein 22
SynonymsRHOGAP2, B230341L19Rik
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33214026-33369934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33369510 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 681 (M681V)
Ref Sequence ENSEMBL: ENSMUSP00000107586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111955] [ENSMUST00000111956]
Predicted Effect probably benign
Transcript: ENSMUST00000111955
AA Change: M516V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107586
Gene: ENSMUSG00000063506
AA Change: M516V

DomainStartEndE-ValueType
Blast:PH 18 57 6e-18 BLAST
RhoGAP 80 187 3.03e-7 SMART
low complexity region 307 318 N/A INTRINSIC
low complexity region 340 381 N/A INTRINSIC
low complexity region 388 398 N/A INTRINSIC
coiled coil region 447 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111956
AA Change: M681V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107587
Gene: ENSMUSG00000063506
AA Change: M681V

DomainStartEndE-ValueType
PH 44 153 1.03e-24 SMART
RhoGAP 176 352 1.96e-65 SMART
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 546 N/A INTRINSIC
low complexity region 553 563 N/A INTRINSIC
coiled coil region 612 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137590
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTPase activating protein family which activates a GTPase belonging to the RAS superfamily of small GTP-binding proteins. The encoded protein is insulin-responsive, is dependent on the kinase Akt and requires the Akt-dependent 14-3-3 binding protein which binds sequentially to two serine residues. The result of these interactions is regulation of cell motility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 noncoding transcript Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 E6G probably damaging Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I519T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 T288A noncoding transcript Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M1006K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 noncoding transcript Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Arhgap22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Arhgap22 APN 14 33359273 missense probably damaging 1.00
IGL02707:Arhgap22 APN 14 33363272 unclassified noncoding transcript
R0329:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0330:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0335:Arhgap22 UTSW 14 33359108 splice site noncoding transcript
R0625:Arhgap22 UTSW 14 33366714 missense probably benign 0.01
R0961:Arhgap22 UTSW 14 33367113 missense probably damaging 0.98
R1167:Arhgap22 UTSW 14 33343307 missense probably damaging 1.00
R1991:Arhgap22 UTSW 14 33366959 missense probably damaging 0.98
R3820:Arhgap22 UTSW 14 33367421 missense probably benign 0.41
R4670:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R4671:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R5177:Arhgap22 UTSW 14 33366693 missense probably benign 0.09
R5910:Arhgap22 UTSW 14 33366615 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTAAGCATCGAGGAGGGC -3'
(R):5'- ATACTGACAGTCCCCATCCTGG -3'

Sequencing Primer
(F):5'- CAGTGCTGACCTGCGGAAG -3'
(R):5'- CTCTCTCTGGCACTTGGAGG -3'
Posted OnJul 06, 2015