Incidental Mutation 'R4377:3632451O06Rik'
ID325165
Institutional Source Beutler Lab
Gene Symbol 3632451O06Rik
Ensembl Gene ENSMUSG00000036242
Gene NameRIKEN cDNA 3632451O06 gene
Synonyms
MMRRC Submission 041676-MU
Accession Numbers

NCBI RefSeq: NM_026142.4; MGI:1914669

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49675952-49783383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49770436 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 527 (T527S)
Ref Sequence ENSEMBL: ENSMUSP00000113609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036972] [ENSMUST00000118129]
Predicted Effect probably damaging
Transcript: ENSMUST00000036972
AA Change: T527S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036220
Gene: ENSMUSG00000036242
AA Change: T527S

DomainStartEndE-ValueType
Pfam:DUF4696 48 609 3.8e-224 PFAM
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118129
AA Change: T527S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113609
Gene: ENSMUSG00000036242
AA Change: T527S

DomainStartEndE-ValueType
coiled coil region 603 644 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 754 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gart G A 16: 91,634,094 A360V probably benign Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C836Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I519T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in 3632451O06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:3632451O06Rik APN 14 49773003 missense probably damaging 1.00
IGL00981:3632451O06Rik APN 14 49772990 missense probably damaging 1.00
IGL01447:3632451O06Rik APN 14 49768466 missense probably damaging 0.99
IGL01645:3632451O06Rik APN 14 49773554 missense probably damaging 1.00
IGL02135:3632451O06Rik APN 14 49773929 missense probably damaging 0.99
IGL02154:3632451O06Rik APN 14 49772942 missense possibly damaging 0.58
IGL02163:3632451O06Rik APN 14 49774157 missense possibly damaging 0.61
IGL03234:3632451O06Rik APN 14 49768516 missense probably damaging 1.00
P0014:3632451O06Rik UTSW 14 49751659 missense probably damaging 1.00
R0165:3632451O06Rik UTSW 14 49773786 missense probably benign
R0240:3632451O06Rik UTSW 14 49768402 splice site probably benign
R0553:3632451O06Rik UTSW 14 49682686 missense probably damaging 0.99
R0616:3632451O06Rik UTSW 14 49773656 missense possibly damaging 0.74
R0635:3632451O06Rik UTSW 14 49773143 missense probably benign 0.00
R1423:3632451O06Rik UTSW 14 49751439 missense probably damaging 1.00
R1547:3632451O06Rik UTSW 14 49773496 missense probably benign 0.01
R1642:3632451O06Rik UTSW 14 49768410 splice site probably null
R1657:3632451O06Rik UTSW 14 49773560 missense probably damaging 0.99
R1717:3632451O06Rik UTSW 14 49751664 missense probably damaging 0.99
R1875:3632451O06Rik UTSW 14 49682358 missense probably damaging 1.00
R1900:3632451O06Rik UTSW 14 49770583 missense probably damaging 1.00
R1916:3632451O06Rik UTSW 14 49768475 missense probably damaging 1.00
R1945:3632451O06Rik UTSW 14 49768483 missense probably damaging 1.00
R2102:3632451O06Rik UTSW 14 49774002 missense probably damaging 0.98
R2147:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R2149:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R3921:3632451O06Rik UTSW 14 49774202 missense probably benign 0.13
R4063:3632451O06Rik UTSW 14 49773987 missense probably benign 0.02
R4373:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4374:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4589:3632451O06Rik UTSW 14 49773582 missense probably damaging 1.00
R4940:3632451O06Rik UTSW 14 49773482 missense probably benign 0.15
R4986:3632451O06Rik UTSW 14 49751654 missense probably damaging 0.97
R5047:3632451O06Rik UTSW 14 49770438 missense probably damaging 1.00
R5104:3632451O06Rik UTSW 14 49773472 missense possibly damaging 0.77
R5682:3632451O06Rik UTSW 14 49751586 missense probably damaging 1.00
R6357:3632451O06Rik UTSW 14 49773312 missense probably benign 0.10
R6478:3632451O06Rik UTSW 14 49773332 missense possibly damaging 0.61
R6673:3632451O06Rik UTSW 14 49770592 missense probably benign 0.00
X0026:3632451O06Rik UTSW 14 49682736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGGTAGGGAACATGTGTG -3'
(R):5'- TCTCTGAAAGAGCTGGCTGC -3'

Sequencing Primer
(F):5'- AACATGTGTGTGCTGGTGAAAG -3'
(R):5'- TCCTTTTCAGACATCACTCAAGAG -3'
Posted OnJul 06, 2015