Incidental Mutation 'R4377:Gart'
ID325171
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 041676-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.988) question?
Stock #R4377 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91634094 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 360 (A360V)
Ref Sequence ENSEMBL: ENSMUSP00000156002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000120450] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000232289] [ENSMUST00000232367]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
AA Change: A360V

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: A360V

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120450
AA Change: A360V

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962
AA Change: A360V

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231380
AA Change: A360V

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231702
Predicted Effect probably benign
Transcript: ENSMUST00000232289
AA Change: A360V

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000232367
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Arhgap22 A G 14: 33,369,510 M681V probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
BC034090 A G 1: 155,232,450 C384R probably benign Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Ccdc180 T A 4: 45,941,877 L1380Q probably damaging Het
Cd209c T C 8: 3,954,635 noncoding transcript Het
Cenpp A G 13: 49,494,431 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Csn1s2a T C 5: 87,775,821 V12A probably benign Het
Dapk1 A G 13: 60,719,684 D235G probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Frmd3 T A 4: 74,128,298 probably null Het
Gm7251 T A 13: 49,805,200 noncoding transcript Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Itgal A G 7: 127,328,281 Y981C probably benign Het
Kcp C T 6: 29,493,203 C107Y probably damaging Het
Kdm2a C T 19: 4,329,054 V138M probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Krt33a T C 11: 100,012,427 E263G possibly damaging Het
Mark2 T C 19: 7,290,689 I50V possibly damaging Het
Mug2 G T 6: 122,071,007 probably null Het
Mvk A G 5: 114,452,961 probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naa15 T C 3: 51,448,365 I229T possibly damaging Het
Napb A C 2: 148,732,264 probably null Het
Ncoa3 T G 2: 166,054,497 L440R possibly damaging Het
Olfr608 T C 7: 103,470,071 S11P probably damaging Het
Olfr965 T A 9: 39,719,807 F193L probably benign Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plekha5 T C 6: 140,579,465 Y376H probably damaging Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Ptprc A T 1: 138,067,925 M982K probably benign Het
Ptpro T A 6: 137,380,266 F252I probably benign Het
Pusl1 A G 4: 155,890,580 V188A probably benign Het
Rad54l2 A G 9: 106,693,222 S1300P probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Rtel1 T A 2: 181,355,796 H1104Q probably damaging Het
Setbp1 T C 18: 78,859,922 R177G probably damaging Het
Skint6 T C 4: 113,236,518 T143A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Zfp583 A G 7: 6,317,681 S111P possibly damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice donor site probably benign
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 unclassified probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGATGGCTCCCTCAAACTTTAG -3'
(R):5'- ACTCCAGCTTGTGTCAAGTTG -3'

Sequencing Primer
(F):5'- CAAACTTTAGAGCAGCGAGTCCTTTC -3'
(R):5'- CCAGCCAGTACAAAGACTATAGGATG -3'
Posted On2015-07-06