Incidental Mutation 'R4379:Zscan4d'
ID325245
Institutional Source Beutler Lab
Gene Symbol Zscan4d
Ensembl Gene ENSMUSG00000090714
Gene Namezinc finger and SCAN domain containing 4D
SynonymsEG545913
MMRRC Submission 041677-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R4379 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location11161374-11166159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11164978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 124 (V124A)
Ref Sequence ENSEMBL: ENSMUSP00000066504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067210] [ENSMUST00000165848]
Predicted Effect probably benign
Transcript: ENSMUST00000067210
AA Change: V124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066504
Gene: ENSMUSG00000090714
AA Change: V124A

DomainStartEndE-ValueType
Pfam:SCAN 39 126 2.5e-19 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 5.14e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094850
AA Change: V124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092446
Gene: ENSMUSG00000090714
AA Change: V124A

DomainStartEndE-ValueType
Pfam:SCAN 30 126 1.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165848
AA Change: V124A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131258
Gene: ENSMUSG00000110103
AA Change: V124A

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.3e-17 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 5.14e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209835
Meta Mutation Damage Score 0.1532 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,865,875 H1252Q probably benign Het
Adcy3 T C 12: 4,134,558 L78P probably damaging Het
Agmat G T 4: 141,757,491 A282S probably benign Het
Akap8 G T 17: 32,306,560 T515K probably damaging Het
Akap8l T C 17: 32,321,514 probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
AW209491 T C 13: 14,637,827 *422Q probably null Het
Cdan1 A G 2: 120,726,618 F576L probably damaging Het
Cers5 A G 15: 99,751,253 F45L probably damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dst A G 1: 34,227,975 I5011V probably benign Het
En1 A G 1: 120,603,355 N108S possibly damaging Het
Fam189b A T 3: 89,185,757 D274V probably damaging Het
Fancd2 T C 6: 113,561,716 S591P probably benign Het
Glt1d1 T C 5: 127,694,282 V279A possibly damaging Het
Gm10051 C T 5: 133,475,448 noncoding transcript Het
Gpr158 G T 2: 21,825,214 G690V probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Grm7 T A 6: 111,246,374 N458K probably benign Het
Hibadh G A 6: 52,620,042 S139L probably damaging Het
Hivep1 C T 13: 42,155,430 S382F probably damaging Het
Ift74 A G 4: 94,679,934 N403D probably benign Het
Igkv4-81 A G 6: 68,990,949 L56S probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lmbr1l G T 15: 98,909,263 C212* probably null Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrc34 A G 3: 30,631,375 L275P probably damaging Het
Mgam2-ps T C 6: 40,833,859 noncoding transcript Het
Mief1 T G 15: 80,247,959 M77R possibly damaging Het
Neurod6 T C 6: 55,679,272 T127A probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nlrp12 T A 7: 3,239,924 T653S probably benign Het
Nol7 G T 13: 43,401,575 W228L probably damaging Het
Nrp1 G A 8: 128,468,467 R468H probably damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 A T 14: 31,067,706 H785L probably damaging Het
Pus7 T C 5: 23,748,866 probably benign Het
Qser1 G T 2: 104,766,059 probably null Het
Rrm1 T C 7: 102,446,593 V51A probably damaging Het
Setbp1 T C 18: 79,086,681 N112S probably damaging Het
Svil C T 18: 5,046,909 H52Y probably damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Treml1 A G 17: 48,360,396 Y103C probably damaging Het
Trim28 A T 7: 13,029,480 D516V probably damaging Het
Usp34 T A 11: 23,384,499 N1164K possibly damaging Het
Vmn2r115 A G 17: 23,345,223 Y123C possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Zmynd8 A T 2: 165,807,938 probably null Het
Other mutations in Zscan4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Zscan4d APN 7 11162354 missense probably benign 0.00
IGL01576:Zscan4d APN 7 11162592 missense possibly damaging 0.91
IGL01926:Zscan4d APN 7 11164994 missense probably damaging 0.98
IGL02008:Zscan4d APN 7 11162369 missense probably benign 0.00
IGL02245:Zscan4d APN 7 11162789 missense probably benign
IGL02473:Zscan4d APN 7 11162409 missense probably benign 0.04
IGL02805:Zscan4d APN 7 11164970 splice site probably benign
IGL03010:Zscan4d APN 7 11163143 missense probably damaging 0.98
IGL03383:Zscan4d APN 7 11162765 missense probably benign 0.07
R0626:Zscan4d UTSW 7 11165019 missense probably damaging 0.97
R1084:Zscan4d UTSW 7 11165005 missense probably damaging 0.99
R1457:Zscan4d UTSW 7 11164994 missense probably damaging 0.98
R2426:Zscan4d UTSW 7 11165095 missense probably damaging 0.99
R2912:Zscan4d UTSW 7 11162687 missense probably benign
R3736:Zscan4d UTSW 7 11162876 missense probably benign
R4580:Zscan4d UTSW 7 11162508 missense probably benign 0.00
R4765:Zscan4d UTSW 7 11162667 missense probably benign 0.08
R4975:Zscan4d UTSW 7 11165347 start codon destroyed probably null 0.02
R6452:Zscan4d UTSW 7 11162072 missense probably damaging 0.98
R6570:Zscan4d UTSW 7 11162000 missense possibly damaging 0.92
R6680:Zscan4d UTSW 7 11162439 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATAGGCTCCTTTCTGCTATATTCATG -3'
(R):5'- AGGAGCTGCAAAGTCTCTGG -3'

Sequencing Primer
(F):5'- ATTTGAGGCAATCATTTTTCTTCAG -3'
(R):5'- AGTCTCTGGAAGATGTTCAACTCCTG -3'
Posted On2015-07-06