Incidental Mutation 'R4382:Acp2'
ID325356
Institutional Source Beutler Lab
Gene Symbol Acp2
Ensembl Gene ENSMUSG00000002103
Gene Nameacid phosphatase 2, lysosomal
SynonymsAcp-2, LAP
MMRRC Submission 041679-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R4382 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91202885-91214098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91208109 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 309 (S309P)
Ref Sequence ENSEMBL: ENSMUSP00000002172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002172] [ENSMUST00000028696] [ENSMUST00000111352] [ENSMUST00000150403] [ENSMUST00000155418]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002172
AA Change: S309P

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002172
Gene: ENSMUSG00000002103
AA Change: S309P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 54 330 1.5e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028696
SMART Domains Protein: ENSMUSP00000028696
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
low complexity region 48 69 N/A INTRINSIC
WD40 100 140 1.48e-2 SMART
WD40 144 185 7.92e1 SMART
WD40 187 229 7.36e1 SMART
WD40 231 271 3.14e-6 SMART
WD40 278 316 3.55e-5 SMART
Blast:WD40 379 419 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111352
SMART Domains Protein: ENSMUSP00000106984
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
WD40 8 49 7.92e1 SMART
WD40 51 93 7.36e1 SMART
WD40 95 135 3.14e-6 SMART
WD40 142 180 3.55e-5 SMART
Blast:WD40 243 283 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135927
Predicted Effect possibly damaging
Transcript: ENSMUST00000150403
AA Change: S276P

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119144
Gene: ENSMUSG00000002103
AA Change: S276P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 159 4e-35 PFAM
Pfam:His_Phos_2 147 297 5.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152277
Predicted Effect probably benign
Transcript: ENSMUST00000155418
SMART Domains Protein: ENSMUSP00000116030
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 166 4e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of lysosomal acid phosphatase (LAP). LAP is chemically and genetically distinct from red cell acid phosphatase. The encoded protein belongs to a family of distinct isoenzymes which hydrolyze orthophosphoric monoesters to alcohol and phosphate. LAP-deficiencies in mice cause multiple defects including bone structure alterations, lysosomal storage defects in the kidneys and central nervous system, and an increased tendency towards seizures. An enzymatically-inactive allele of LAP in mice exhibited a more severe phenotype than the null allele, and defects included cerebellum abnormalities, growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutation of this gene result in skeletal defects and a small percentage of mutant animals exhibit tonic-clonic seizures. Mice with a missense mutation (Gly244Glu) are growth retarded and exhibit a disrupted cerebellum cytoarchitecture, an abnormal hair shaft, and skin malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 noncoding transcript Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kel T A 6: 41,698,400 T306S probably benign Het
Lpo T C 11: 87,822,201 D25G probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagk A G 6: 83,798,011 E90G probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Wtap A G 17: 12,975,420 S87P probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Acp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Acp2 APN 2 91203683 missense probably damaging 1.00
IGL02251:Acp2 APN 2 91208333 unclassified probably null
IGL02445:Acp2 APN 2 91206261 missense possibly damaging 0.63
IGL02952:Acp2 APN 2 91208443 unclassified probably benign
IGL03272:Acp2 APN 2 91204233 splice site probably benign
R0781:Acp2 UTSW 2 91208422 unclassified probably null
R1110:Acp2 UTSW 2 91208422 unclassified probably null
R2107:Acp2 UTSW 2 91203595 splice site probably benign
R4726:Acp2 UTSW 2 91204277 missense probably damaging 1.00
R4737:Acp2 UTSW 2 91210723 missense probably benign 0.26
R4793:Acp2 UTSW 2 91206789 missense probably benign 0.13
R4817:Acp2 UTSW 2 91203618 missense probably damaging 1.00
R5089:Acp2 UTSW 2 91211922 unclassified probably benign
R5092:Acp2 UTSW 2 91208046 missense probably benign 0.19
R5468:Acp2 UTSW 2 91206098 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTTTATTCCGCGGTAAGC -3'
(R):5'- CATTCCGAAAGTACATCTCGACTG -3'

Sequencing Primer
(F):5'- CGGTAAGCATCAACCCTATCC -3'
(R):5'- CTCGACTGAGAAATTCCTGAGAGTTG -3'
Posted On2015-07-06