Incidental Mutation 'R4382:Nagk'
ID325368
Institutional Source Beutler Lab
Gene Symbol Nagk
Ensembl Gene ENSMUSG00000034744
Gene NameN-acetylglucosamine kinase
SynonymsGlcNAc kinase
MMRRC Submission 041679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4382 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83794982-83804018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83798011 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 90 (E90G)
Ref Sequence ENSEMBL: ENSMUSP00000109481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037376] [ENSMUST00000113850] [ENSMUST00000113851]
Predicted Effect probably benign
Transcript: ENSMUST00000037376
AA Change: E90G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042026
Gene: ENSMUSG00000034744
AA Change: E90G

DomainStartEndE-ValueType
Pfam:BcrAD_BadFG 6 294 6.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113850
AA Change: E90G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109481
Gene: ENSMUSG00000034744
AA Change: E90G

DomainStartEndE-ValueType
Pfam:BcrAD_BadFG 6 233 5.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113851
AA Change: E108G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109482
Gene: ENSMUSG00000034744
AA Change: E108G

DomainStartEndE-ValueType
Pfam:BcrAD_BadFG 28 302 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205681
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetylhexosamine kinase family. The encoded protein catalyzes the conversion of N-acetyl-D-glucosamine to N-acetyl-D-glucosamine 6-phosphate, and is the major mammalian enzyme which recovers amino sugars. [provided by RefSeq, Nov 2011]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 S309P possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Gm6811 T C 17: 21,094,603 noncoding transcript Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kel T A 6: 41,698,400 T306S probably benign Het
Lpo T C 11: 87,822,201 D25G probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Wtap A G 17: 12,975,420 S87P probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Nagk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Nagk APN 6 83799370 missense probably damaging 0.98
IGL02167:Nagk APN 6 83801106 missense probably damaging 0.98
R0414:Nagk UTSW 6 83797267 nonsense probably null
R1809:Nagk UTSW 6 83797187 missense probably benign 0.01
R1901:Nagk UTSW 6 83799354 missense probably damaging 1.00
R3837:Nagk UTSW 6 83801157 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TTTCCTAGGCCAGGCTGTTC -3'
(R):5'- TGCCTTCCAGATGTAGGTAAGTTC -3'

Sequencing Primer
(F):5'- TGTTCCTGCAGGCATGGC -3'
(R):5'- ATGTAGGTAAGTTCTGCCAGCCAC -3'
Posted On2015-07-06