Incidental Mutation 'R4382:Gm6811'
ID325394
Institutional Source Beutler Lab
Gene Symbol Gm6811
Ensembl Gene ENSMUSG00000091550
Gene Namepredicted gene 6811
Synonyms
MMRRC Submission 041679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4382 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21093172-21094704 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 21094603 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000169389]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169389
SMART Domains Protein: ENSMUSP00000127210
Gene: ENSMUSG00000091550

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
S_TKc 28 276 2.2e-84 SMART
low complexity region 290 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188185
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T C 2: 91,208,109 S309P possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
B4galnt4 T C 7: 141,070,536 V772A probably damaging Het
BC067074 T C 13: 113,322,754 I1273T probably benign Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Ccdc92b G A 11: 74,630,016 S48N probably damaging Het
Ceacam12 C T 7: 18,066,034 probably benign Het
Clca3a1 T A 3: 144,760,722 M1L probably benign Het
Cnot1 T C 8: 95,769,779 T300A probably damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Col6a6 G A 9: 105,783,690 R407W probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddx60 G A 8: 61,948,978 probably null Het
Dnajb12 A T 10: 59,897,499 K372N probably benign Het
Fhl5 A C 4: 25,200,118 C239G probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Glrb T A 3: 80,879,639 R72S probably damaging Het
Gm13124 T A 4: 144,555,026 T399S possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hk2 A T 6: 82,735,341 L542Q probably null Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kel T A 6: 41,698,400 T306S probably benign Het
Lpo T C 11: 87,822,201 D25G probably benign Het
Mboat7 T A 7: 3,688,546 Y109F possibly damaging Het
Myh15 T G 16: 49,142,943 N1082K probably benign Het
Nagk A G 6: 83,798,011 E90G probably benign Het
Nagpa A T 16: 5,203,955 F10I possibly damaging Het
Olfr460 T A 6: 40,572,064 L226H probably damaging Het
Otog T A 7: 46,289,698 C2051S probably damaging Het
Ptpn6 A G 6: 124,727,398 V315A possibly damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rnf41 T C 10: 128,436,523 S140P probably benign Het
Ros1 C T 10: 52,120,959 V1206I possibly damaging Het
Scgb2b12 T A 7: 32,325,445 E112D probably benign Het
Serpinb3b T A 1: 107,155,543 M210L probably damaging Het
Sipa1l1 A G 12: 82,446,822 R1672G possibly damaging Het
Smc5 A G 19: 23,268,846 S70P probably benign Het
Spen C T 4: 141,473,139 G2703S possibly damaging Het
Stard9 C G 2: 120,634,222 A56G probably damaging Het
Wtap A G 17: 12,975,420 S87P probably damaging Het
Zzef1 T G 11: 72,875,112 S1488R probably benign Het
Other mutations in Gm6811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03290:Gm6811 APN 17 21094049 intron noncoding transcript
R1666:Gm6811 UTSW 17 21094267 intron noncoding transcript
R1677:Gm6811 UTSW 17 21093923 intron noncoding transcript
R4763:Gm6811 UTSW 17 21093847 intron noncoding transcript
R4928:Gm6811 UTSW 17 21094631 intron noncoding transcript
R6276:Gm6811 UTSW 17 21093983 intron noncoding transcript
R6276:Gm6811 UTSW 17 21094690 intron noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCAGGCCACACCAGATGAC -3'
(R):5'- ATTGCGTCTCTGCTGGGAAG -3'

Sequencing Primer
(F):5'- GATGACACCCACACAGGAC -3'
(R):5'- TCTCTGCTGGGAAGAGGAGAAATTC -3'
Posted On2015-07-06