Incidental Mutation 'R4383:Arih2'
List |< first << previous [record 92 of 1308] next >> last >|
ID325414
Institutional Source Beutler Lab
Gene Symbol Arih2
Ensembl Gene ENSMUSG00000064145
Gene Nameariadne RBR E3 ubiquitin protein ligase 2
SynonymsTRIAD1
MMRRC Submission 041123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4383 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108602942-108649386 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to G at 108644277 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000013338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013338] [ENSMUST00000193190] [ENSMUST00000193197] [ENSMUST00000193552] [ENSMUST00000193643]
Predicted Effect probably benign
Transcript: ENSMUST00000013338
AA Change: M1L

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000013338
Gene: ENSMUSG00000064145
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 1.21e-1 SMART
IBR 207 269 7.29e-23 SMART
ZnF_C2HC 255 271 2.03e0 SMART
IBR 277 339 1.81e-9 SMART
RING 299 339 5.86e-1 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193190
AA Change: M1L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141914
Gene: ENSMUSG00000064145
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
RING 138 171 5.7e-4 SMART
IBR 207 269 2.5e-25 SMART
ZnF_C2HC 255 271 8.4e-3 SMART
Blast:IBR 277 317 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193197
SMART Domains Protein: ENSMUSP00000141911
Gene: ENSMUSG00000064145

DomainStartEndE-ValueType
IBR 1 36 1.5e-3 SMART
ZnF_C2HC 22 38 8.4e-3 SMART
Blast:IBR 44 79 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193552
Predicted Effect probably benign
Transcript: ENSMUST00000193643
AA Change: M1L

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141369
Gene: ENSMUSG00000064145
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195623
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 89% (32/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that polyubiquitinates some proteins, tagging them for degradation. The encoded protein upregulates p53 in some cancer cells and may inhibit myelopoiesis. Several transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been determined yet. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene causes altered dendritic cell physiology, enhanced liver apoptosis, and complete fetal lethality that is partially modified by genetic background. On a mixed genetic background, mice that survive past weaning succumb to a severe multiorgan inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Asic3 A G 5: 24,413,934 T75A probably damaging Het
Baat C T 4: 49,499,731 A192T probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Clca3a2 T C 3: 144,806,320 I552V probably benign Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Des T C 1: 75,360,769 F118L possibly damaging Het
Ermard T C 17: 15,059,866 S130P possibly damaging Het
Fbxl5 A G 5: 43,762,963 probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Inmt C A 6: 55,171,218 C142F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kmt2c A T 5: 25,351,062 D1228E possibly damaging Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Msh2 G A 17: 87,689,138 E425K probably benign Het
Olfr430 T C 1: 174,069,477 Y60H probably benign Het
Poc1b A G 10: 99,156,299 D326G probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rsf1 A G 7: 97,685,476 K1272R possibly damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Trim3 C T 7: 105,618,399 A264T probably damaging Het
Ubr2 G C 17: 46,939,387 H1545D probably benign Het
Vps13a A T 19: 16,701,165 C1151S probably damaging Het
Zap70 C T 1: 36,780,961 R471W probably damaging Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Other mutations in Arih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Arih2 APN 9 108605410 missense probably damaging 1.00
IGL03213:Arih2 APN 9 108607347 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0009:Arih2 UTSW 9 108611727 missense probably damaging 1.00
R0314:Arih2 UTSW 9 108608679 missense probably damaging 1.00
R0413:Arih2 UTSW 9 108616717 missense probably damaging 0.98
R0450:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0469:Arih2 UTSW 9 108605092 missense possibly damaging 0.57
R0865:Arih2 UTSW 9 108649300 utr 5 prime probably benign
R2099:Arih2 UTSW 9 108616738 missense probably damaging 1.00
R2913:Arih2 UTSW 9 108644076 missense probably damaging 1.00
R4636:Arih2 UTSW 9 108613814 missense probably damaging 1.00
R5033:Arih2 UTSW 9 108611660 unclassified probably benign
R5562:Arih2 UTSW 9 108607347 missense probably damaging 1.00
R5976:Arih2 UTSW 9 108607973 makesense probably null
R6248:Arih2 UTSW 9 108611642 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTCAGACTCCTTATAGGTCAAGC -3'
(R):5'- AGATAGGCTGTCATGGGAGC -3'

Sequencing Primer
(F):5'- CAGACTCCTTATAGGTCAAGCAAGTG -3'
(R):5'- CTGTCATGGGAGCAGGGCTAG -3'
Posted On2015-07-06