Incidental Mutation 'R4395:Ifit3b'
ID325467
Institutional Source Beutler Lab
Gene Symbol Ifit3b
Ensembl Gene ENSMUSG00000062488
Gene Nameinterferon-induced protein with tetratricopeptide repeats 3B
SynonymsI830012O16Rik
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R4395 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34607970-34613401 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 34612551 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 376 (E376*)
Ref Sequence ENSEMBL: ENSMUSP00000075599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076249] [ENSMUST00000087357] [ENSMUST00000112463]
Predicted Effect probably null
Transcript: ENSMUST00000076249
AA Change: E376*
SMART Domains Protein: ENSMUSP00000075599
Gene: ENSMUSG00000062488
AA Change: E376*

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 5e-6 BLAST
TPR 241 274 1.02e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087357
SMART Domains Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112463
SMART Domains Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Soga3 T C 10: 29,147,355 S233P probably benign Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Ifit3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
galilee UTSW 19 34611525 missense probably benign
negev UTSW 19 34611460 missense probably benign 0.14
R1528:Ifit3b UTSW 19 34611672 missense probably benign 0.05
R1996:Ifit3b UTSW 19 34611477 missense probably damaging 1.00
R2680:Ifit3b UTSW 19 34612305 missense probably benign 0.01
R2971:Ifit3b UTSW 19 34612017 nonsense probably null
R4719:Ifit3b UTSW 19 34612630 missense probably damaging 0.96
R4726:Ifit3b UTSW 19 34611460 missense probably benign 0.14
R5094:Ifit3b UTSW 19 34612548 missense possibly damaging 0.93
R5958:Ifit3b UTSW 19 34611742 missense probably benign 0.02
R5987:Ifit3b UTSW 19 34612198 missense probably damaging 1.00
R6381:Ifit3b UTSW 19 34612471 missense probably benign 0.00
R6614:Ifit3b UTSW 19 34611519 missense probably benign 0.01
R6662:Ifit3b UTSW 19 34611937 missense probably damaging 1.00
R6804:Ifit3b UTSW 19 34611547 missense possibly damaging 0.92
R6847:Ifit3b UTSW 19 34611525 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGACTCTTCAGAGGAGGCG -3'
(R):5'- CGGTTGTCCTCAGGTTCATG -3'

Sequencing Primer
(F):5'- AGGCGAAGTCCTTTGAACTC -3'
(R):5'- AAGTGTGTTGCCTCCCAAAC -3'
Posted On2015-07-06