Incidental Mutation 'R4396:Traf5'
ID325474
Institutional Source Beutler Lab
Gene Symbol Traf5
Ensembl Gene ENSMUSG00000026637
Gene NameTNF receptor-associated factor 5
Synonyms
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191997205-192092559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 191997845 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 415 (V415E)
Ref Sequence ENSEMBL: ENSMUSP00000082710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085573]
Predicted Effect probably benign
Transcript: ENSMUST00000085573
AA Change: V415E

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082710
Gene: ENSMUSG00000026637
AA Change: V415E

DomainStartEndE-ValueType
RING 45 84 1.74e-4 SMART
Pfam:zf-TRAF 128 183 4.8e-21 PFAM
Pfam:zf-TRAF 183 241 4.2e-19 PFAM
MATH 402 525 2.42e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175262
Predicted Effect unknown
Transcript: ENSMUST00000192628
AA Change: V112E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195647
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice show defects in lymphocyte activation but are otherwise viable and develop normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Traf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Traf5 APN 1 192057174 missense possibly damaging 0.95
IGL01462:Traf5 APN 1 191999867 missense probably benign
IGL02262:Traf5 APN 1 191997675 missense probably damaging 1.00
IGL02579:Traf5 APN 1 191999887 missense probably damaging 0.99
IGL03308:Traf5 APN 1 191997500 missense probably damaging 0.99
PIT4445001:Traf5 UTSW 1 191997807 missense
R0028:Traf5 UTSW 1 192074121 intron probably benign
R0689:Traf5 UTSW 1 191997876 missense probably benign 0.16
R1511:Traf5 UTSW 1 191999951 missense probably benign 0.01
R1641:Traf5 UTSW 1 191997509 missense probably benign 0.20
R2235:Traf5 UTSW 1 192054391 missense probably damaging 1.00
R2246:Traf5 UTSW 1 192066890 splice site probably null
R2301:Traf5 UTSW 1 191997965 missense probably benign 0.01
R3973:Traf5 UTSW 1 191997876 missense probably benign 0.16
R4793:Traf5 UTSW 1 191997804 missense probably benign 0.38
R4834:Traf5 UTSW 1 192066898 missense probably benign 0.10
R5779:Traf5 UTSW 1 191997672 missense probably damaging 1.00
R5795:Traf5 UTSW 1 191999846 missense probably benign 0.00
R5843:Traf5 UTSW 1 191997485 missense possibly damaging 0.55
R5912:Traf5 UTSW 1 191998069 intron probably benign
R5963:Traf5 UTSW 1 192000016 missense probably benign 0.06
R6246:Traf5 UTSW 1 192070553 missense probably damaging 0.99
R6287:Traf5 UTSW 1 191999872 missense probably damaging 1.00
R6455:Traf5 UTSW 1 191999926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCAAAAGCATCAGGGTCAC -3'
(R):5'- GGTAGTGCTCAGATGACAGG -3'

Sequencing Primer
(F):5'- GGTCACCCTCTGCCTGAAC -3'
(R):5'- TCAGATGACAGGCCCGAG -3'
Posted On2015-07-06