Incidental Mutation 'R4396:Zswim1'
ID325478
Institutional Source Beutler Lab
Gene Symbol Zswim1
Ensembl Gene ENSMUSG00000017764
Gene Namezinc finger SWIM-type containing 1
Synonyms
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164822686-164826871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164825449 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 207 (D207G)
Ref Sequence ENSEMBL: ENSMUSP00000017908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017908] [ENSMUST00000017911] [ENSMUST00000052107] [ENSMUST00000132282]
Predicted Effect probably damaging
Transcript: ENSMUST00000017908
AA Change: D207G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017908
Gene: ENSMUSG00000017764
AA Change: D207G

DomainStartEndE-ValueType
Pfam:SWIM 342 375 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017911
SMART Domains Protein: ENSMUSP00000017911
Gene: ENSMUSG00000017767

DomainStartEndE-ValueType
Pfam:SPATA25 1 226 3.2e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052107
SMART Domains Protein: ENSMUSP00000050970
Gene: ENSMUSG00000045822

DomainStartEndE-ValueType
low complexity region 436 453 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
ZnF_PMZ 546 573 2.09e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141411
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Other mutations in Zswim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Zswim1 UTSW 2 164826126 missense probably damaging 0.99
R0321:Zswim1 UTSW 2 164826027 missense probably benign 0.02
R0490:Zswim1 UTSW 2 164825283 missense possibly damaging 0.90
R1795:Zswim1 UTSW 2 164825400 missense probably benign
R4213:Zswim1 UTSW 2 164825785 missense probably benign 0.15
R5191:Zswim1 UTSW 2 164826019 missense probably benign
R5290:Zswim1 UTSW 2 164825925 missense probably damaging 1.00
R6178:Zswim1 UTSW 2 164826052 unclassified probably null
R6547:Zswim1 UTSW 2 164824796 start gained probably benign
R7247:Zswim1 UTSW 2 164825799 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACATCTGCAAGTTCCTCCAGG -3'
(R):5'- AAGGAGTGTGACTGTCCTGG -3'

Sequencing Primer
(F):5'- CAGGGTAAATTCTATCAGCTGCCG -3'
(R):5'- ACTGTCCTGGGGTGTCTC -3'
Posted On2015-07-06