Incidental Mutation 'R4396:Traip'
ID325491
Institutional Source Beutler Lab
Gene Symbol Traip
Ensembl Gene ENSMUSG00000032586
Gene NameTRAF-interacting protein
SynonymsTrip
MMRRC Submission 041129-MU
Accession Numbers

NCBI RefSeq: NM_011634.3; MGI:1096377

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107950136-107972270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 107959487 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 110 (T110S)
Ref Sequence ENSEMBL: ENSMUSP00000040001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049348] [ENSMUST00000194271]
Predicted Effect probably benign
Transcript: ENSMUST00000049348
AA Change: T110S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586
AA Change: T110S

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194191
Predicted Effect probably benign
Transcript: ENSMUST00000194271
AA Change: T94S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141689
Gene: ENSMUSG00000032586
AA Change: T94S

DomainStartEndE-ValueType
RING 7 49 3.2e-8 SMART
coiled coil region 54 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195803
Meta Mutation Damage Score 0.0504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 3764469
Lethality: E7-E9
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an N-terminal RING finger motif and a putative coiled-coil domain. A similar murine protein interacts with TNFR-associated factor 1 (TRAF1), TNFR-associated factor 2 (TRAF2), and cylindromatosis. The interaction with TRAF2 inhibits TRAF2-mediated nuclear factor kappa-B, subunit 1 activation that is required for cell activation and protection against apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at prior to E8.5, embryonic growth retardation, decreased embryonic size, decreased cell proliferation and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(1) Gene trapped(9)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Traip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Traip APN 9 107970550 missense probably benign 0.15
IGL01457:Traip APN 9 107970472 missense probably benign 0.00
IGL01597:Traip APN 9 107955924 critical splice donor site probably null
IGL02197:Traip APN 9 107968737 missense possibly damaging 0.89
IGL03077:Traip APN 9 107962926 unclassified probably benign
IGL03226:Traip APN 9 107970993 missense probably damaging 0.97
P0016:Traip UTSW 9 107968656 missense possibly damaging 0.93
R1693:Traip UTSW 9 107970030 missense probably damaging 0.99
R2054:Traip UTSW 9 107962919 missense probably benign 0.08
R4617:Traip UTSW 9 107970019 missense probably benign 0.00
R6151:Traip UTSW 9 107970619 critical splice donor site probably null
R6241:Traip UTSW 9 107968734 missense probably benign 0.33
R6920:Traip UTSW 9 107961041 nonsense probably null
R7177:Traip UTSW 9 107960985 missense possibly damaging 0.62
R7191:Traip UTSW 9 107970017 missense probably benign
X0018:Traip UTSW 9 107961656 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTAGCTTAGACTTCCCGG -3'
(R):5'- ACAAAGGCATTGGTTGAGGC -3'

Sequencing Primer
(F):5'- AGCTTAGACTTCCCGGTGCAC -3'
(R):5'- GCCTTTAATCTCTACACTTGGGAGG -3'
Posted On2015-07-06