Incidental Mutation 'R4396:Plxnb1'
ID325492
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109100223 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 49 (V49A)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072093
AA Change: V49A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: V49A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130366
AA Change: V49A

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646
AA Change: V49A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131462
AA Change: V49A

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646
AA Change: V49A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134690
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 109100718 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 109100175 missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7428:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7443:Plxnb1 UTSW 9 109114607 missense probably damaging 1.00
R7527:Plxnb1 UTSW 9 109100861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTTGAGTCTCGCCCAACC -3'
(R):5'- GGTCATTTGCAGCCACATAC -3'

Sequencing Primer
(F):5'- AACCTTTTTCTCTGCCAGGTGAC -3'
(R):5'- AGCAGCTGCCTGATCTGTC -3'
Posted On2015-07-06