Incidental Mutation 'R4396:Sirt1'
ID325493
Institutional Source Beutler Lab
Gene Symbol Sirt1
Ensembl Gene ENSMUSG00000020063
Gene Namesirtuin 1
SynonymsSir2, Sir2alpha
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63319005-63381704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63321998 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 546 (T546A)
Ref Sequence ENSEMBL: ENSMUSP00000112595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020257] [ENSMUST00000020258] [ENSMUST00000105442] [ENSMUST00000120239] [ENSMUST00000146028] [ENSMUST00000177694] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020257
AA Change: T546A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020257
Gene: ENSMUSG00000020063
AA Change: T546A

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 1.3e-62 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000020258
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105442
AA Change: T507A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101082
Gene: ENSMUSG00000020063
AA Change: T507A

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
Pfam:SIR2 214 400 4e-63 PFAM
PDB:4KXQ|B 590 609 3e-6 PDB
low complexity region 610 628 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120239
AA Change: T546A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112595
Gene: ENSMUSG00000020063
AA Change: T546A

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 6.5e-64 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146028
SMART Domains Protein: ENSMUSP00000117819
Gene: ENSMUSG00000020063

DomainStartEndE-ValueType
Pfam:SIR2 83 140 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148516
Predicted Effect probably benign
Transcript: ENSMUST00000177694
SMART Domains Protein: ENSMUSP00000137565
Gene: ENSMUSG00000020063

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 7.3e-63 PFAM
low complexity region 465 483 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219789
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a member of the sirtuin family of proteins, characterized by their deacetylase activity and proposed role in longevity. The encoded protein regulates gene expression in a wide range of cell and tissue types through its NAD+-dependent deacetylation of histones, transcription factors and transcriptional coactivators. Brain-specific overexpression of this gene has been shown to result in increased median lifespan. Viability of homozygous knockout mice for this gene varies with strain background. Homozygous knockout mice of strains that do not exhibit embryonic lethality are sterile and have a reduced lifespan. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic and fetal lethality, abnormal embryogenesis, and abnormal cellular phenotypes of derived MEFs. Mice homozygous for other knock-out alleles may exhibit peri- and postnatal lethality and heart, mammary gland, eye, and reproductive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Sirt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Sirt1 APN 10 63325203 missense probably damaging 1.00
IGL02106:Sirt1 APN 10 63335829 missense probably damaging 1.00
PIT4283001:Sirt1 UTSW 10 63321786 missense probably benign 0.02
R0658:Sirt1 UTSW 10 63321736 unclassified probably benign
R0724:Sirt1 UTSW 10 63323973 missense possibly damaging 0.82
R1653:Sirt1 UTSW 10 63321809 missense probably benign
R1831:Sirt1 UTSW 10 63320646 missense probably benign 0.13
R4133:Sirt1 UTSW 10 63335659 missense probably null 0.42
R4250:Sirt1 UTSW 10 63337098 critical splice acceptor site probably null
R4378:Sirt1 UTSW 10 63338949 missense probably benign 0.00
R4776:Sirt1 UTSW 10 63335722 missense probably benign 0.17
R4898:Sirt1 UTSW 10 63322004 missense probably benign 0.35
R7151:Sirt1 UTSW 10 63323996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGCCAGCATTTTCTCACTG -3'
(R):5'- TCATAGGCTAGGTGGTGAATATGC -3'

Sequencing Primer
(F):5'- CTCACTGTTTCTGCAACTGAAG -3'
(R):5'- CTAGGTGGTGAATATGCCAAACTTTG -3'
Posted On2015-07-06