Incidental Mutation 'R4396:Gemin5'
ID325495
Institutional Source Beutler Lab
Gene Symbol Gemin5
Ensembl Gene ENSMUSG00000037275
Gene Namegem nuclear organelle associated protein 5
Synonyms
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58120002-58168539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58139549 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 817 (T817S)
Ref Sequence ENSEMBL: ENSMUSP00000099772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000172035]
Predicted Effect probably benign
Transcript: ENSMUST00000035604
AA Change: T817S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275
AA Change: T817S

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102711
AA Change: T817S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275
AA Change: T817S

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134733
Predicted Effect probably benign
Transcript: ENSMUST00000172035
AA Change: T817S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275
AA Change: T817S

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Gemin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Gemin5 APN 11 58163817 missense probably damaging 1.00
IGL00540:Gemin5 APN 11 58160818 missense probably damaging 1.00
IGL01521:Gemin5 APN 11 58134918 splice site probably benign
IGL02190:Gemin5 APN 11 58134842 missense probably damaging 1.00
IGL02274:Gemin5 APN 11 58156795 missense possibly damaging 0.80
IGL02494:Gemin5 APN 11 58121757 missense probably benign 0.12
IGL02549:Gemin5 APN 11 58134803 missense probably damaging 1.00
IGL02740:Gemin5 APN 11 58151564 missense probably damaging 1.00
IGL02815:Gemin5 APN 11 58146409 missense probably damaging 1.00
IGL02823:Gemin5 APN 11 58167705 splice site probably benign
IGL02939:Gemin5 APN 11 58156730 missense probably damaging 1.00
Landscape UTSW 11 58163904 missense probably benign 0.16
R0101:Gemin5 UTSW 11 58145496 missense probably damaging 1.00
R0479:Gemin5 UTSW 11 58139551 missense probably benign 0.00
R1481:Gemin5 UTSW 11 58141654 missense probably damaging 1.00
R1642:Gemin5 UTSW 11 58139080 missense probably damaging 1.00
R1648:Gemin5 UTSW 11 58147979 nonsense probably null
R1980:Gemin5 UTSW 11 58136917 missense probably damaging 1.00
R3079:Gemin5 UTSW 11 58145519 missense probably damaging 1.00
R3418:Gemin5 UTSW 11 58156628 intron probably null
R4260:Gemin5 UTSW 11 58168359 missense probably damaging 0.99
R4902:Gemin5 UTSW 11 58164277 missense probably benign 0.18
R5178:Gemin5 UTSW 11 58146518 missense probably benign 0.01
R5296:Gemin5 UTSW 11 58130061 missense probably damaging 1.00
R5350:Gemin5 UTSW 11 58141586 critical splice donor site probably null
R5426:Gemin5 UTSW 11 58125287 missense probably benign 0.00
R5494:Gemin5 UTSW 11 58130700 missense probably damaging 1.00
R5744:Gemin5 UTSW 11 58155183 missense possibly damaging 0.88
R5889:Gemin5 UTSW 11 58122355 missense possibly damaging 0.76
R5984:Gemin5 UTSW 11 58156761 missense probably damaging 1.00
R6844:Gemin5 UTSW 11 58163904 missense probably benign 0.16
R6934:Gemin5 UTSW 11 58147912 missense probably damaging 1.00
R6999:Gemin5 UTSW 11 58125121 missense probably benign 0.00
R7015:Gemin5 UTSW 11 58156740 missense probably damaging 1.00
R7144:Gemin5 UTSW 11 58141663 missense probably benign 0.30
R7176:Gemin5 UTSW 11 58166002 missense probably benign 0.05
X0066:Gemin5 UTSW 11 58151535 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCTTCACTAACGTAAATAAGTGC -3'
(R):5'- AGTTTCCAAATCACCGTCCG -3'

Sequencing Primer
(F):5'- AAGTGCTATCAACAACTGTAAGAC -3'
(R):5'- CCGGGTGATAGATTTAGACATTCC -3'
Posted On2015-07-06