Incidental Mutation 'R4396:Actn2'
ID325499
Institutional Source Beutler Lab
Gene Symbol Actn2
Ensembl Gene ENSMUSG00000052374
Gene Nameactinin alpha 2
Synonyms
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12269426-12340760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12310879 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 70 (L70P)
Ref Sequence ENSEMBL: ENSMUSP00000129609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064204] [ENSMUST00000168193]
Predicted Effect probably damaging
Transcript: ENSMUST00000064204
AA Change: L70P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067708
Gene: ENSMUSG00000052374
AA Change: L70P

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 2e-16 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110616
SMART Domains Protein: ENSMUSP00000106246
Gene: ENSMUSG00000052374

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168193
AA Change: L70P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129609
Gene: ENSMUSG00000052374
AA Change: L70P

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 7e-18 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Actn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Actn2 APN 13 12310910 missense possibly damaging 0.50
IGL01909:Actn2 APN 13 12309593 critical splice donor site probably null
IGL01994:Actn2 APN 13 12290677 missense probably benign 0.26
IGL02118:Actn2 APN 13 12276547 intron probably benign
IGL02480:Actn2 APN 13 12276478 missense probably benign 0.02
IGL02827:Actn2 APN 13 12275199 missense probably damaging 1.00
IGL03110:Actn2 APN 13 12309607 missense probably benign 0.02
R0044:Actn2 UTSW 13 12275127 missense possibly damaging 0.51
R0512:Actn2 UTSW 13 12277415 missense probably damaging 1.00
R1623:Actn2 UTSW 13 12340439 missense probably benign
R1983:Actn2 UTSW 13 12278810 missense probably benign 0.00
R1989:Actn2 UTSW 13 12340395 missense probably benign 0.38
R2148:Actn2 UTSW 13 12300949 missense probably damaging 0.99
R2196:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R2254:Actn2 UTSW 13 12296479 missense probably benign 0.20
R2850:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R4391:Actn2 UTSW 13 12290748 missense probably damaging 0.99
R4758:Actn2 UTSW 13 12288586 nonsense probably null
R5068:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5069:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5070:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5228:Actn2 UTSW 13 12288659 critical splice acceptor site probably null
R5382:Actn2 UTSW 13 12308951 missense probably benign 0.37
R5408:Actn2 UTSW 13 12270795 missense probably benign 0.41
R5975:Actn2 UTSW 13 12340497 missense probably benign 0.43
R6189:Actn2 UTSW 13 12276440 missense probably damaging 1.00
R6226:Actn2 UTSW 13 12278967 missense probably benign
R6498:Actn2 UTSW 13 12276473 missense probably damaging 1.00
R7094:Actn2 UTSW 13 12309657 missense probably damaging 1.00
R7164:Actn2 UTSW 13 12278961 missense probably damaging 1.00
R7218:Actn2 UTSW 13 12278913 missense probably benign 0.33
R7260:Actn2 UTSW 13 12276490 missense probably benign 0.00
X0018:Actn2 UTSW 13 12269645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTCTCTCTGTACCCTAGG -3'
(R):5'- TCATAGACCCTCTAGAAGGTTCCAG -3'

Sequencing Primer
(F):5'- CTCGTGACTCAGACTGGAATTACAG -3'
(R):5'- TTCCAGGTGCTGTCCATGAAAAAG -3'
Posted On2015-07-06