Incidental Mutation 'R4396:Rreb1'
ID325500
Institutional Source Beutler Lab
Gene Symbol Rreb1
Ensembl Gene ENSMUSG00000039087
Gene Nameras responsive element binding protein 1
Synonyms1110037N09Rik, B930013M22Rik
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location37778400-37952005 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 37930443 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 593 (Q593*)
Ref Sequence ENSEMBL: ENSMUSP00000121211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037232] [ENSMUST00000110237] [ENSMUST00000110238] [ENSMUST00000124373] [ENSMUST00000128570] [ENSMUST00000149745]
Predicted Effect probably null
Transcript: ENSMUST00000037232
AA Change: Q593*
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087
AA Change: Q593*

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110237
AA Change: Q593*
SMART Domains Protein: ENSMUSP00000105866
Gene: ENSMUSG00000039087
AA Change: Q593*

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110238
AA Change: Q593*
SMART Domains Protein: ENSMUSP00000105867
Gene: ENSMUSG00000039087
AA Change: Q593*

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124268
Predicted Effect probably benign
Transcript: ENSMUST00000124373
Predicted Effect probably null
Transcript: ENSMUST00000128570
AA Change: Q593*
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087
AA Change: Q593*

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149745
AA Change: Q593*
SMART Domains Protein: ENSMUSP00000121211
Gene: ENSMUSG00000039087
AA Change: Q593*

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to RAS-responsive elements (RREs) of gene promoters. It has been shown that the calcitonin gene promoter contains an RRE and that the encoded protein binds there and increases expression of calcitonin, which may be involved in Ras/Raf-mediated cell differentiation. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Rreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Rreb1 APN 13 37916496 missense probably benign 0.09
IGL00336:Rreb1 APN 13 37929646 nonsense probably null
IGL00473:Rreb1 APN 13 37930791 nonsense probably null
IGL01338:Rreb1 APN 13 37931034 missense probably benign 0.09
IGL01836:Rreb1 APN 13 37931457 missense probably damaging 1.00
IGL02066:Rreb1 APN 13 37931506 missense probably benign 0.16
IGL02661:Rreb1 APN 13 37930802 nonsense probably null
IGL02739:Rreb1 APN 13 37893821 missense probably damaging 1.00
IGL03267:Rreb1 APN 13 37932193 missense probably benign 0.30
IGL03332:Rreb1 APN 13 37930916 missense probably benign 0.42
IGL03403:Rreb1 APN 13 37929574 missense possibly damaging 0.78
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0101:Rreb1 UTSW 13 37931542 missense probably benign 0.04
R0265:Rreb1 UTSW 13 37916155 nonsense probably null
R0635:Rreb1 UTSW 13 37941564 missense possibly damaging 0.92
R0939:Rreb1 UTSW 13 37932231 missense probably benign 0.09
R1099:Rreb1 UTSW 13 37948891 missense probably benign 0.16
R1438:Rreb1 UTSW 13 37930605 missense probably benign 0.16
R1457:Rreb1 UTSW 13 37946928 missense possibly damaging 0.52
R1510:Rreb1 UTSW 13 37931884 missense probably benign 0.04
R1672:Rreb1 UTSW 13 37930537 missense probably benign 0.09
R1772:Rreb1 UTSW 13 37930923 missense probably benign 0.09
R2171:Rreb1 UTSW 13 37930846 missense probably benign 0.00
R2371:Rreb1 UTSW 13 37916537 missense probably benign 0.09
R2566:Rreb1 UTSW 13 37929792 missense possibly damaging 0.62
R2571:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R2862:Rreb1 UTSW 13 37932453 missense probably benign 0.02
R2874:Rreb1 UTSW 13 37916508 missense probably benign 0.09
R2911:Rreb1 UTSW 13 37948920 missense probably benign 0.00
R3722:Rreb1 UTSW 13 37947098 missense probably benign 0.01
R3767:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3770:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3885:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3886:Rreb1 UTSW 13 37898506 splice site probably null
R3887:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3888:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3889:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R4064:Rreb1 UTSW 13 37930317 missense probably benign 0.42
R4134:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4135:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4174:Rreb1 UTSW 13 37930150 missense possibly damaging 0.95
R4250:Rreb1 UTSW 13 37893893 missense possibly damaging 0.63
R4287:Rreb1 UTSW 13 37931931 missense probably benign 0.03
R4658:Rreb1 UTSW 13 37948801 missense probably damaging 1.00
R4841:Rreb1 UTSW 13 37916526 missense probably benign 0.09
R4856:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R4886:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R5092:Rreb1 UTSW 13 37928278 missense probably benign 0.09
R5122:Rreb1 UTSW 13 37930768 missense probably benign 0.02
R5405:Rreb1 UTSW 13 37949111 missense probably damaging 0.99
R5408:Rreb1 UTSW 13 37931344 missense probably benign 0.01
R5446:Rreb1 UTSW 13 37898497 missense possibly damaging 0.78
R5641:Rreb1 UTSW 13 37947421 missense probably benign 0.00
R5859:Rreb1 UTSW 13 37947408 missense probably benign 0.24
R5859:Rreb1 UTSW 13 37947409 missense probably benign 0.06
R6429:Rreb1 UTSW 13 37932129 missense probably benign 0.03
R6678:Rreb1 UTSW 13 37899699 missense probably damaging 1.00
R7130:Rreb1 UTSW 13 37899748 missense probably damaging 1.00
R7186:Rreb1 UTSW 13 37941632 missense probably benign 0.02
R7188:Rreb1 UTSW 13 37916568 missense possibly damaging 0.79
X0024:Rreb1 UTSW 13 37931580 missense probably benign 0.09
X0026:Rreb1 UTSW 13 37931992 missense probably benign 0.17
Z1088:Rreb1 UTSW 13 37948937 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTCCCGGTTGTATCAGCC -3'
(R):5'- ATTGGTAGGGTGAGATGCCC -3'

Sequencing Primer
(F):5'- GTTGTATCAGCCCCAGCC -3'
(R):5'- CTCGCAGGACTCCAGAGAAAG -3'
Posted On2015-07-06