Incidental Mutation 'R4396:Kcnj4'
ID325505
Institutional Source Beutler Lab
Gene Symbol Kcnj4
Ensembl Gene ENSMUSG00000044216
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 4
SynonymsMB-IRK3, Kir 2.3, Kcnf2, IRK3
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79483714-79505241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79484673 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 369 (A369S)
Ref Sequence ENSEMBL: ENSMUSP00000094075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057801]
Predicted Effect probably benign
Transcript: ENSMUST00000057801
AA Change: A369S

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000094075
Gene: ENSMUSG00000044216
AA Change: A369S

DomainStartEndE-ValueType
Pfam:IRK 22 361 2.1e-155 PFAM
coiled coil region 371 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229365
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Kcnj4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Kcnj4 APN 15 79484579 missense probably benign 0.01
IGL02263:Kcnj4 APN 15 79485787 utr 5 prime probably benign
IGL02551:Kcnj4 APN 15 79484902 missense probably benign 0.05
R1305:Kcnj4 UTSW 15 79484819 missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79485404 missense probably damaging 1.00
R1464:Kcnj4 UTSW 15 79485404 missense probably damaging 1.00
R1475:Kcnj4 UTSW 15 79484630 missense probably damaging 1.00
R1844:Kcnj4 UTSW 15 79485015 missense probably damaging 1.00
R3906:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R3907:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
R3908:Kcnj4 UTSW 15 79485745 missense probably benign 0.01
X0062:Kcnj4 UTSW 15 79485690 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATATTGTCCAGTGGAAGGGTG -3'
(R):5'- CTCCTATCTGGCCAGTGAGATC -3'

Sequencing Primer
(F):5'- GCTTGCATGCGCTCCAGATC -3'
(R):5'- CTATCTGGCCAGTGAGATCCTGTG -3'
Posted On2015-07-06