Incidental Mutation 'R4396:Gm8909'
ID325513
Institutional Source Beutler Lab
Gene Symbol Gm8909
Ensembl Gene ENSMUSG00000073402
Gene Namepredicted gene 8909
Synonyms
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4396 (G1)
Quality Score171
Status Validated
Chromosome17
Chromosomal Location36164443-36168537 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 36161969 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040467] [ENSMUST00000097335] [ENSMUST00000173353]
Predicted Effect probably benign
Transcript: ENSMUST00000040467
SMART Domains Protein: ENSMUSP00000036092
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 26 204 5.9e-96 PFAM
IGc1 223 294 8.23e-23 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090537
SMART Domains Protein: ENSMUSP00000088025
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 105 173 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097335
SMART Domains Protein: ENSMUSP00000094947
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 7.3e-96 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173025
SMART Domains Protein: ENSMUSP00000133655
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 148 216 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173353
SMART Domains Protein: ENSMUSP00000133663
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 3.9e-93 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174752
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mtus2 T A 5: 148,203,938 N871K possibly damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Gm8909
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Gm8909 APN 17 36165354 critical splice donor site probably null
IGL00534:Gm8909 APN 17 36168129 missense probably damaging 1.00
IGL02312:Gm8909 APN 17 36165407 missense probably benign 0.01
IGL03346:Gm8909 APN 17 36168109 missense probably damaging 1.00
H8441:Gm8909 UTSW 17 36167982 missense possibly damaging 0.84
R0005:Gm8909 UTSW 17 36162192 unclassified probably benign
R0078:Gm8909 UTSW 17 36165461 missense possibly damaging 0.95
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0553:Gm8909 UTSW 17 36168057 missense probably damaging 1.00
R0670:Gm8909 UTSW 17 36168098 missense possibly damaging 0.74
R1718:Gm8909 UTSW 17 36161784 unclassified probably benign
R1937:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R2571:Gm8909 UTSW 17 36167661 missense possibly damaging 0.66
R4393:Gm8909 UTSW 17 36161969 unclassified probably benign
R4409:Gm8909 UTSW 17 36165850 missense possibly damaging 0.53
R4505:Gm8909 UTSW 17 36161480 unclassified probably benign
R4506:Gm8909 UTSW 17 36161480 unclassified probably benign
R4507:Gm8909 UTSW 17 36161480 unclassified probably benign
R4579:Gm8909 UTSW 17 36161757 unclassified probably benign
R4684:Gm8909 UTSW 17 36165858 missense possibly damaging 0.90
R4740:Gm8909 UTSW 17 36167556 missense probably damaging 1.00
R5087:Gm8909 UTSW 17 36165416 nonsense probably null
R5103:Gm8909 UTSW 17 36161685 unclassified probably benign
R5275:Gm8909 UTSW 17 36161675 unclassified probably null
R5425:Gm8909 UTSW 17 36168485 missense probably damaging 1.00
R6155:Gm8909 UTSW 17 36167507 missense possibly damaging 0.93
R6727:Gm8909 UTSW 17 36165730 missense probably damaging 1.00
R6852:Gm8909 UTSW 17 36168073 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AATACCGCATCGAGTGTGAGC -3'
(R):5'- CCCCATTAGATAGCAAGATCTTGG -3'

Sequencing Primer
(F):5'- CATCGAGTGTGAGCCTGAG -3'
(R):5'- TTAGATAGCAAGATCTTGGGAAACC -3'
Posted On2015-07-06