Incidental Mutation 'R4397:Hjurp'
ID325519
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4397 (G1)
Quality Score118
Status Validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GT to GTT at 88266524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- AACTGTCATGGTTTGTGATGCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On2015-07-06