Incidental Mutation 'R4399:Thrap3'
ID325624
Institutional Source Beutler Lab
Gene Symbol Thrap3
Ensembl Gene ENSMUSG00000043962
Gene Namethyroid hormone receptor associated protein 3
Synonyms9330151F09Rik, B230333E16Rik, Trap150
MMRRC Submission 041686-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R4399 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126164082-126202760 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 126167079 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000080919] [ENSMUST00000094760] [ENSMUST00000097891] [ENSMUST00000163176]
Predicted Effect probably benign
Transcript: ENSMUST00000080919
SMART Domains Protein: ENSMUSP00000079722
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 788 1.9e-207 PFAM
low complexity region 790 801 N/A INTRINSIC
low complexity region 835 854 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094760
SMART Domains Protein: ENSMUSP00000092352
Gene: ENSMUSG00000073758

DomainStartEndE-ValueType
SH3 68 125 7.11e-22 SMART
low complexity region 211 221 N/A INTRINSIC
low complexity region 464 473 N/A INTRINSIC
coiled coil region 482 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097891
SMART Domains Protein: ENSMUSP00000095501
Gene: ENSMUSG00000073758

DomainStartEndE-ValueType
SH3 1 57 4.29e-7 SMART
low complexity region 66 76 N/A INTRINSIC
SH3 86 141 2.96e-19 SMART
SH3 184 241 7.11e-22 SMART
low complexity region 327 337 N/A INTRINSIC
low complexity region 580 589 N/A INTRINSIC
coiled coil region 598 626 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154702
Predicted Effect probably benign
Transcript: ENSMUST00000163176
Predicted Effect probably benign
Transcript: ENSMUST00000163459
SMART Domains Protein: ENSMUSP00000129775
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 39 4e-17 PFAM
low complexity region 41 58 N/A INTRINSIC
low complexity region 59 77 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
Pfam:Btz 124 192 3.1e-4 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,936,385 T1466A possibly damaging Het
Abcc6 T C 7: 46,002,607 N612S probably benign Het
Aga T C 8: 53,511,826 S8P probably benign Het
Cep152 G A 2: 125,587,980 A674V possibly damaging Het
Chd6 T C 2: 160,965,318 H1992R probably benign Het
Cnga1 T C 5: 72,604,381 K597E probably damaging Het
Col6a5 T A 9: 105,888,965 M1919L possibly damaging Het
Cramp1l C T 17: 24,979,585 V788I probably damaging Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Foxred2 A C 15: 77,953,358 V226G possibly damaging Het
Foxred2 T C 15: 77,955,680 I137V probably benign Het
G6pd2 T A 5: 61,810,173 N430K probably benign Het
Gtf2h3 T C 5: 124,602,063 probably benign Het
Ibsp T A 5: 104,309,282 S86T probably damaging Het
Igkv6-25 T A 6: 70,215,710 S34T possibly damaging Het
Mrc2 T A 11: 105,336,658 Y572* probably null Het
Mup18 C T 4: 61,672,629 G97D probably damaging Het
Olfr1286 T G 2: 111,420,799 I51L probably benign Het
Olfr347 A T 2: 36,735,230 N303I probably benign Het
Olfr59 A G 11: 74,288,856 D70G probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prkcz A T 4: 155,269,077 I454N possibly damaging Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ralgapa1 T A 12: 55,795,778 probably null Het
Ryr3 A T 2: 112,946,844 S323T probably benign Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Setd1b C T 5: 123,161,798 probably benign Het
Sh2d3c G A 2: 32,746,160 G332D probably damaging Het
Slc2a7 A G 4: 150,158,550 E276G probably damaging Het
Slc35b3 A G 13: 38,937,815 F73L possibly damaging Het
Sstr3 T G 15: 78,540,124 D141A probably damaging Het
St8sia5 T C 18: 77,253,018 C191R probably damaging Het
Sult1c1 T C 17: 53,962,510 N230S probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem151a A G 19: 5,083,071 S36P probably damaging Het
Vmn1r67 A G 7: 10,447,549 T247A possibly damaging Het
Vmn2r50 A G 7: 10,047,907 S304P possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Thrap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00654:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00763:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00907:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00990:Thrap3 APN 4 126165395 unclassified probably benign
IGL01722:Thrap3 APN 4 126165529 missense possibly damaging 0.87
IGL02487:Thrap3 APN 4 126167001 missense possibly damaging 0.93
IGL02802:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02837:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02988:Thrap3 UTSW 4 126165542 splice site probably null
IGL03050:Thrap3 UTSW 4 126165542 splice site probably null
IGL03055:Thrap3 UTSW 4 126165542 splice site probably null
R0585:Thrap3 UTSW 4 126178574 unclassified probably null
R1023:Thrap3 UTSW 4 126180089 missense possibly damaging 0.73
R1237:Thrap3 UTSW 4 126180069 missense probably benign 0.02
R1445:Thrap3 UTSW 4 126176336 missense probably damaging 1.00
R1601:Thrap3 UTSW 4 126180101 missense probably damaging 1.00
R2058:Thrap3 UTSW 4 126180174 missense probably damaging 1.00
R2063:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2064:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2065:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2066:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2067:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2098:Thrap3 UTSW 4 126180030 missense probably damaging 1.00
R3791:Thrap3 UTSW 4 126167500 missense possibly damaging 0.76
R4052:Thrap3 UTSW 4 126176219 missense probably damaging 1.00
R4097:Thrap3 UTSW 4 126171802 missense probably damaging 1.00
R4153:Thrap3 UTSW 4 126173442 critical splice donor site probably null
R5265:Thrap3 UTSW 4 126167640 missense probably damaging 1.00
R5687:Thrap3 UTSW 4 126180486 unclassified probably benign
R5993:Thrap3 UTSW 4 126175460 unclassified probably null
R6305:Thrap3 UTSW 4 126180807 unclassified probably benign
R6917:Thrap3 UTSW 4 126180492 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCCTTCAAATGAGCACC -3'
(R):5'- GCCTCTGACTATGTACACCC -3'

Sequencing Primer
(F):5'- ATGTACAAAAAGGCTTCCTGC -3'
(R):5'- GACTATGTACACCCCCTGGACTG -3'
Posted On2015-07-06