Incidental Mutation 'R4399:Sstr3'
ID325649
Institutional Source Beutler Lab
Gene Symbol Sstr3
Ensembl Gene ENSMUSG00000044933
Gene Namesomatostatin receptor 3
Synonymssst3, Smstr-3, Smstr3
MMRRC Submission 041686-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4399 (G1)
Quality Score160
Status Validated
Chromosome15
Chromosomal Location78537008-78544685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78540124 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 141 (D141A)
Ref Sequence ENSEMBL: ENSMUSP00000058040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]
Predicted Effect probably damaging
Transcript: ENSMUST00000053239
AA Change: D141A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: D141A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 291 1.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 337 3.5e-15 PFAM
Pfam:7tm_1 62 322 6.3e-60 PFAM
Pfam:7TM_GPCR_Srv 121 337 9.5e-8 PFAM
coiled coil region 355 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230400
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,936,385 T1466A possibly damaging Het
Abcc6 T C 7: 46,002,607 N612S probably benign Het
Aga T C 8: 53,511,826 S8P probably benign Het
Cep152 G A 2: 125,587,980 A674V possibly damaging Het
Chd6 T C 2: 160,965,318 H1992R probably benign Het
Cnga1 T C 5: 72,604,381 K597E probably damaging Het
Col6a5 T A 9: 105,888,965 M1919L possibly damaging Het
Cramp1l C T 17: 24,979,585 V788I probably damaging Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Foxred2 A C 15: 77,953,358 V226G possibly damaging Het
Foxred2 T C 15: 77,955,680 I137V probably benign Het
G6pd2 T A 5: 61,810,173 N430K probably benign Het
Gtf2h3 T C 5: 124,602,063 probably benign Het
Ibsp T A 5: 104,309,282 S86T probably damaging Het
Igkv6-25 T A 6: 70,215,710 S34T possibly damaging Het
Mrc2 T A 11: 105,336,658 Y572* probably null Het
Mup18 C T 4: 61,672,629 G97D probably damaging Het
Olfr1286 T G 2: 111,420,799 I51L probably benign Het
Olfr347 A T 2: 36,735,230 N303I probably benign Het
Olfr59 A G 11: 74,288,856 D70G probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prkcz A T 4: 155,269,077 I454N possibly damaging Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ralgapa1 T A 12: 55,795,778 probably null Het
Ryr3 A T 2: 112,946,844 S323T probably benign Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Setd1b C T 5: 123,161,798 probably benign Het
Sh2d3c G A 2: 32,746,160 G332D probably damaging Het
Slc2a7 A G 4: 150,158,550 E276G probably damaging Het
Slc35b3 A G 13: 38,937,815 F73L possibly damaging Het
St8sia5 T C 18: 77,253,018 C191R probably damaging Het
Sult1c1 T C 17: 53,962,510 N230S probably benign Het
Thrap3 A G 4: 126,167,079 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem151a A G 19: 5,083,071 S36P probably damaging Het
Vmn1r67 A G 7: 10,447,549 T247A possibly damaging Het
Vmn2r50 A G 7: 10,047,907 S304P possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Sstr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sstr3 APN 15 78540467 missense probably benign 0.00
R0442:Sstr3 UTSW 15 78540397 missense probably damaging 0.99
R1714:Sstr3 UTSW 15 78540273 missense probably damaging 1.00
R1865:Sstr3 UTSW 15 78539968 missense probably damaging 1.00
R2008:Sstr3 UTSW 15 78540511 missense probably benign 0.14
R2351:Sstr3 UTSW 15 78539921 missense probably benign 0.01
R3023:Sstr3 UTSW 15 78539987 missense probably damaging 0.99
R3024:Sstr3 UTSW 15 78539987 missense probably damaging 0.99
R3770:Sstr3 UTSW 15 78540377 missense probably damaging 1.00
R4724:Sstr3 UTSW 15 78539697 nonsense probably null
R6181:Sstr3 UTSW 15 78539461 missense probably benign
R6247:Sstr3 UTSW 15 78539588 missense probably damaging 0.99
X0026:Sstr3 UTSW 15 78539374 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CGGCCGTGTAGATGATGAAG -3'
(R):5'- GTGACCAGTGTCTATATCCTCAAC -3'

Sequencing Primer
(F):5'- AGATGATGAAGGCTGTTCGC -3'
(R):5'- AACCTGGCTCTGGCTGATGAG -3'
Posted On2015-07-06