Mutagenetix > Incidental Mutation

Incidental Mutation 'R4364:Apoa5'

325674

Institutional Source

Beutler Lab

Gene Symbol

Apoa5

Ensembl Gene

ENSMUSG00000032079

Gene Name

apolipoprotein A-V

Synonyms

1300007O05Rik, RAP3, Apoav

MMRRC Submission

041672-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4364 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

46179931-46183217 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46181827 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 301 (D301V)

Ref Sequence

ENSEMBL: ENSMUSP00000113413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000215458] [ENSMUST00000214202] [ENSMUST00000215187]

AlphaFold

Q8C7G5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034584
AA Change: D301V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: D301V

Domain	Start	End	E-Value	Type
Pfam:Apolipoprotein	52	264	5.1e-59	PFAM
Pfam:Apolipoprotein	258	315	1.8e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114552

SMART Domains

Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
Zpr1	12	150	5.57e-30	SMART
Zpr1	184	343	4.27e-90	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121598
AA Change: D301V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: D301V

Domain	Start	End	E-Value	Type
Pfam:Apolipoprotein	51	305	8.1e-66	PFAM
low complexity region	312	323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125239

SMART Domains

Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
low complexity region	11	32	N/A	INTRINSIC
Blast:Zpr1	33	59	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141763

Predicted Effect

probably benign
Transcript: ENSMUST00000156440

SMART Domains

Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

Domain	Start	End	E-Value	Type
low complexity region	9	30	N/A	INTRINSIC
Zpr1	49	207	1.47e-93	SMART
low complexity region	236	246	N/A	INTRINSIC
Zpr1	257	416	4.27e-90	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213878

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215484

Predicted Effect

probably benign
Transcript: ENSMUST00000215458

Predicted Effect

probably benign
Transcript: ENSMUST00000214202

Predicted Effect

probably benign
Transcript: ENSMUST00000215187

Meta Mutation Damage Score

0.1519

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

93% (40/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amn	A	C	12: 111,238,196 (GRCm39)	N37H	probably damaging	Het
Atrn	A	G	2: 130,812,128 (GRCm39)	E691G	probably benign	Het
Ccer1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	10: 97,530,232 (GRCm39)		probably benign	Het
Cct2	A	G	10: 116,891,056 (GRCm39)	V396A	probably damaging	Het
Dhx35	C	T	2: 158,684,272 (GRCm39)	Q516*	probably null	Het
Dop1b	A	G	16: 93,567,812 (GRCm39)	K1413R	probably benign	Het
Dpp9	T	C	17: 56,494,391 (GRCm39)	H856R	possibly damaging	Het
Eif4e2	T	C	1: 87,152,093 (GRCm39)	F97L	probably benign	Het
Exoc6b	A	T	6: 84,980,161 (GRCm39)		probably benign	Het
Fat1	T	A	8: 45,405,999 (GRCm39)	S917T	probably benign	Het
Frem1	A	T	4: 82,831,488 (GRCm39)	Y2043N	probably damaging	Het
Galnt14	A	G	17: 73,819,154 (GRCm39)	I312T	probably damaging	Het
Glipr1	T	C	10: 111,821,542 (GRCm39)	N220S	possibly damaging	Het
Grid1	A	G	14: 34,667,989 (GRCm39)	E172G	probably benign	Het
Hspa4l	C	A	3: 40,721,241 (GRCm39)		probably null	Het
Il1rl2	G	T	1: 40,390,951 (GRCm39)	R298L	probably benign	Het
Il7r	T	A	15: 9,513,014 (GRCm39)	H165L	probably damaging	Het
Krt87	T	G	15: 101,385,395 (GRCm39)	M326L	probably benign	Het
Lcn10	G	T	2: 25,574,052 (GRCm39)	C85F	probably damaging	Het
Mideas	C	T	12: 84,203,245 (GRCm39)	G886S	probably benign	Het
Nup205	C	A	6: 35,168,962 (GRCm39)	P397Q	probably benign	Het
Or4d10	A	G	19: 12,051,861 (GRCm39)	V45A	probably benign	Het
Or4f17-ps1	G	A	2: 111,357,985 (GRCm39)	V127M	probably benign	Het
Or8b12c	A	T	9: 37,715,486 (GRCm39)	H93L	probably benign	Het
Prkce	C	T	17: 86,784,279 (GRCm39)	T218I	probably damaging	Het
Rhbdl2	T	A	4: 123,703,728 (GRCm39)	M1K	probably null	Het
Ripor2	C	T	13: 24,905,694 (GRCm39)	P947S	probably benign	Het
Shoc1	T	G	4: 59,082,294 (GRCm39)	T445P	possibly damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Sptbn5	A	G	2: 119,899,136 (GRCm39)	L428P	probably damaging	Het
Syne1	A	G	10: 5,303,987 (GRCm39)	V789A	probably damaging	Het
Taar8c	C	T	10: 23,977,477 (GRCm39)	V112M	probably benign	Het
Tex10	T	C	4: 48,468,774 (GRCm39)	I51V	probably benign	Het
Ttll1	T	A	15: 83,384,195 (GRCm39)	Q144L	probably damaging	Het

Other mutations in Apoa5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02084:Apoa5	APN	9	46,181,950 (GRCm39)	missense	probably damaging	0.98
IGL02089:Apoa5	APN	9	46,180,437 (GRCm39)	critical splice donor site	probably null
R0046:Apoa5	UTSW	9	46,181,296 (GRCm39)	missense	probably damaging	1.00
R1722:Apoa5	UTSW	9	46,181,847 (GRCm39)	nonsense	probably null
R2007:Apoa5	UTSW	9	46,181,665 (GRCm39)	missense	possibly damaging	0.95
R2356:Apoa5	UTSW	9	46,181,341 (GRCm39)	missense	probably damaging	0.98
R3739:Apoa5	UTSW	9	46,180,415 (GRCm39)	missense	probably damaging	1.00
R3835:Apoa5	UTSW	9	46,181,878 (GRCm39)	missense	probably damaging	1.00
R4657:Apoa5	UTSW	9	46,181,170 (GRCm39)	missense	probably benign	0.12
R4760:Apoa5	UTSW	9	46,181,593 (GRCm39)	missense	probably damaging	0.97
R5160:Apoa5	UTSW	9	46,181,794 (GRCm39)	missense	probably damaging	0.99
R5523:Apoa5	UTSW	9	46,181,887 (GRCm39)	missense	possibly damaging	0.79
R5915:Apoa5	UTSW	9	46,180,607 (GRCm39)	missense	probably damaging	1.00
R6106:Apoa5	UTSW	9	46,181,931 (GRCm39)	nonsense	probably null
R6849:Apoa5	UTSW	9	46,181,298 (GRCm39)	missense	probably benign	0.03
R7170:Apoa5	UTSW	9	46,181,437 (GRCm39)	missense	probably benign	0.00
R9268:Apoa5	UTSW	9	46,181,719 (GRCm39)	missense	probably benign	0.18
R9403:Apoa5	UTSW	9	46,181,944 (GRCm39)	missense	probably damaging	1.00
R9495:Apoa5	UTSW	9	46,181,944 (GRCm39)	missense	probably damaging	1.00
R9499:Apoa5	UTSW	9	46,181,944 (GRCm39)	missense	probably damaging	1.00
Z1177:Apoa5	UTSW	9	46,180,417 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCACACGTAAGGCGAAGGAC -3'
(R):5'- TCAGGGTCACTCAAATGACTATGAC -3'

Sequencing Primer
(F):5'- TAAGGCGAAGGACCTGCACAC -3'
(R):5'- ACTATGACCCTGGTCTTGAAGGC -3'

Posted On

2015-07-06