Incidental Mutation 'R4364:Ccer1'
List |< first << previous [record 69 of 585] next >> last >|
ID325676
Institutional Source Beutler Lab
Gene Symbol Ccer1
Ensembl Gene ENSMUSG00000047025
Gene Namecoiled-coil glutamate-rich protein 1
Synonyms
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R4364 (G1)
Quality Score121
Status Not validated
Chromosome10
Chromosomal Location97693059-97694923 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA at 97694370 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060703]
Predicted Effect probably benign
Transcript: ENSMUST00000060703
SMART Domains Protein: ENSMUSP00000050554
Gene: ENSMUSG00000047025

DomainStartEndE-ValueType
Pfam:CCER1 4 218 5.9e-123 PFAM
coiled coil region 292 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220233
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Ccer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Ccer1 APN 10 97694539 missense probably benign 0.18
IGL01434:Ccer1 APN 10 97693597 missense unknown
IGL01895:Ccer1 APN 10 97694050 missense unknown
IGL02030:Ccer1 APN 10 97693610 missense unknown
IGL02962:Ccer1 APN 10 97693840 missense unknown
IGL03352:Ccer1 APN 10 97693577 missense unknown
R1083:Ccer1 UTSW 10 97694658 missense possibly damaging 0.70
R1911:Ccer1 UTSW 10 97694677 missense possibly damaging 0.53
R3769:Ccer1 UTSW 10 97694552 missense probably damaging 1.00
R5737:Ccer1 UTSW 10 97694684 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GACTCCACTACCAATGATGCG -3'
(R):5'- AAGGCATTCCCAGAGGCAAG -3'

Sequencing Primer
(F):5'- CAGCGGCGTCGAAGAAGATTC -3'
(R):5'- GCATTCCCAGAGGCAAGAATTTTTC -3'
Posted On2015-07-06