Mutagenetix > Incidental Mutation

Incidental Mutation 'R4364:Ripor2'

325681

Institutional Source

Beutler Lab

Gene Symbol

Ripor2

Ensembl Gene

ENSMUSG00000036006

Gene Name

RHO family interacting cell polarization regulator 2

Synonyms

1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik

MMRRC Submission

041672-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R4364 (G1)

Quality Score

189

Status

Validated

Chromosome

Chromosomal Location

24685513-24917789 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24905694 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 947 (P947S)

Ref Sequence

ENSEMBL: ENSMUSP00000106013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110383] [ENSMUST00000110384]

AlphaFold

Q80U16

Predicted Effect

probably benign
Transcript: ENSMUST00000110383
AA Change: P922S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: P922S

Domain	Start	End	E-Value	Type
coiled coil region	83	112	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	630	639	N/A	INTRINSIC
low complexity region	657	672	N/A	INTRINSIC
low complexity region	857	864	N/A	INTRINSIC
SCOP:d1gw5a_	901	1023	2e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110384
AA Change: P947S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: P947S

Domain	Start	End	E-Value	Type
Pfam:PL48	41	389	6e-174	PFAM
low complexity region	461	476	N/A	INTRINSIC
low complexity region	655	664	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	882	889	N/A	INTRINSIC
SCOP:d1gw5a_	926	1048	2e-9	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

93% (40/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amn	A	C	12: 111,238,196 (GRCm39)	N37H	probably damaging	Het
Apoa5	A	T	9: 46,181,827 (GRCm39)	D301V	probably damaging	Het
Atrn	A	G	2: 130,812,128 (GRCm39)	E691G	probably benign	Het
Ccer1	CGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	10: 97,530,232 (GRCm39)		probably benign	Het
Cct2	A	G	10: 116,891,056 (GRCm39)	V396A	probably damaging	Het
Dhx35	C	T	2: 158,684,272 (GRCm39)	Q516*	probably null	Het
Dop1b	A	G	16: 93,567,812 (GRCm39)	K1413R	probably benign	Het
Dpp9	T	C	17: 56,494,391 (GRCm39)	H856R	possibly damaging	Het
Eif4e2	T	C	1: 87,152,093 (GRCm39)	F97L	probably benign	Het
Exoc6b	A	T	6: 84,980,161 (GRCm39)		probably benign	Het
Fat1	T	A	8: 45,405,999 (GRCm39)	S917T	probably benign	Het
Frem1	A	T	4: 82,831,488 (GRCm39)	Y2043N	probably damaging	Het
Galnt14	A	G	17: 73,819,154 (GRCm39)	I312T	probably damaging	Het
Glipr1	T	C	10: 111,821,542 (GRCm39)	N220S	possibly damaging	Het
Grid1	A	G	14: 34,667,989 (GRCm39)	E172G	probably benign	Het
Hspa4l	C	A	3: 40,721,241 (GRCm39)		probably null	Het
Il1rl2	G	T	1: 40,390,951 (GRCm39)	R298L	probably benign	Het
Il7r	T	A	15: 9,513,014 (GRCm39)	H165L	probably damaging	Het
Krt87	T	G	15: 101,385,395 (GRCm39)	M326L	probably benign	Het
Lcn10	G	T	2: 25,574,052 (GRCm39)	C85F	probably damaging	Het
Mideas	C	T	12: 84,203,245 (GRCm39)	G886S	probably benign	Het
Nup205	C	A	6: 35,168,962 (GRCm39)	P397Q	probably benign	Het
Or4d10	A	G	19: 12,051,861 (GRCm39)	V45A	probably benign	Het
Or4f17-ps1	G	A	2: 111,357,985 (GRCm39)	V127M	probably benign	Het
Or8b12c	A	T	9: 37,715,486 (GRCm39)	H93L	probably benign	Het
Prkce	C	T	17: 86,784,279 (GRCm39)	T218I	probably damaging	Het
Rhbdl2	T	A	4: 123,703,728 (GRCm39)	M1K	probably null	Het
Shoc1	T	G	4: 59,082,294 (GRCm39)	T445P	possibly damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Sptbn5	A	G	2: 119,899,136 (GRCm39)	L428P	probably damaging	Het
Syne1	A	G	10: 5,303,987 (GRCm39)	V789A	probably damaging	Het
Taar8c	C	T	10: 23,977,477 (GRCm39)	V112M	probably benign	Het
Tex10	T	C	4: 48,468,774 (GRCm39)	I51V	probably benign	Het
Ttll1	T	A	15: 83,384,195 (GRCm39)	Q144L	probably damaging	Het

Other mutations in Ripor2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ripor2	APN	13	24,885,190 (GRCm39)	missense	probably benign	0.11
IGL02145:Ripor2	APN	13	24,901,554 (GRCm39)	missense	probably damaging	1.00
IGL02351:Ripor2	APN	13	24,915,572 (GRCm39)	missense	probably damaging	1.00
IGL02358:Ripor2	APN	13	24,915,572 (GRCm39)	missense	probably damaging	1.00
IGL02377:Ripor2	APN	13	24,879,549 (GRCm39)	splice site	probably benign
IGL02533:Ripor2	APN	13	24,885,378 (GRCm39)	nonsense	probably null
IGL02798:Ripor2	APN	13	24,858,649 (GRCm39)	missense	probably damaging	0.99
IGL02852:Ripor2	APN	13	24,879,681 (GRCm39)	missense	probably damaging	1.00
IGL02869:Ripor2	APN	13	24,880,512 (GRCm39)	missense	possibly damaging	0.46
IGL03219:Ripor2	APN	13	24,907,702 (GRCm39)	missense	probably damaging	1.00
gentleman	UTSW	13	24,878,128 (GRCm39)	missense	probably damaging	1.00
Jack	UTSW	13	24,861,824 (GRCm39)	nonsense	probably null
whitechapel	UTSW	13	24,857,095 (GRCm39)	critical splice donor site	probably null
R0045:Ripor2	UTSW	13	24,878,209 (GRCm39)	missense	probably damaging	1.00
R0101:Ripor2	UTSW	13	24,864,615 (GRCm39)	missense	probably damaging	1.00
R0731:Ripor2	UTSW	13	24,864,627 (GRCm39)	missense	probably damaging	1.00
R0827:Ripor2	UTSW	13	24,878,169 (GRCm39)	missense	probably damaging	1.00
R1331:Ripor2	UTSW	13	24,861,824 (GRCm39)	nonsense	probably null
R1374:Ripor2	UTSW	13	24,857,095 (GRCm39)	critical splice donor site	probably null
R1564:Ripor2	UTSW	13	24,859,768 (GRCm39)	missense	probably damaging	1.00
R1773:Ripor2	UTSW	13	24,885,237 (GRCm39)	missense	probably benign	0.10
R1889:Ripor2	UTSW	13	24,877,870 (GRCm39)	missense	probably damaging	1.00
R2122:Ripor2	UTSW	13	24,897,701 (GRCm39)	missense	probably damaging	0.98
R2137:Ripor2	UTSW	13	24,905,817 (GRCm39)	critical splice donor site	probably null
R2209:Ripor2	UTSW	13	24,885,595 (GRCm39)	missense	probably damaging	1.00
R2242:Ripor2	UTSW	13	24,855,755 (GRCm39)	missense	probably benign	0.08
R2392:Ripor2	UTSW	13	24,890,206 (GRCm39)	missense	probably benign	0.00
R2994:Ripor2	UTSW	13	24,885,610 (GRCm39)	missense	probably damaging	0.98
R4008:Ripor2	UTSW	13	24,880,521 (GRCm39)	missense	probably benign
R4287:Ripor2	UTSW	13	24,908,992 (GRCm39)	missense	probably damaging	1.00
R4365:Ripor2	UTSW	13	24,905,694 (GRCm39)	missense	probably benign	0.07
R4366:Ripor2	UTSW	13	24,905,694 (GRCm39)	missense	probably benign	0.07
R4868:Ripor2	UTSW	13	24,878,124 (GRCm39)	missense	possibly damaging	0.88
R5304:Ripor2	UTSW	13	24,858,649 (GRCm39)	missense	probably damaging	0.99
R6119:Ripor2	UTSW	13	24,798,627 (GRCm39)	start gained	probably benign
R6157:Ripor2	UTSW	13	24,885,052 (GRCm39)	missense	probably damaging	1.00
R6178:Ripor2	UTSW	13	24,894,113 (GRCm39)	missense	possibly damaging	0.94
R6382:Ripor2	UTSW	13	24,861,828 (GRCm39)	missense	possibly damaging	0.89
R6664:Ripor2	UTSW	13	24,859,803 (GRCm39)	missense	probably damaging	0.98
R6908:Ripor2	UTSW	13	24,890,215 (GRCm39)	missense	probably damaging	1.00
R7023:Ripor2	UTSW	13	24,855,829 (GRCm39)	missense	probably benign	0.00
R7041:Ripor2	UTSW	13	24,877,749 (GRCm39)	missense	probably benign	0.18
R7196:Ripor2	UTSW	13	24,888,808 (GRCm39)	missense	possibly damaging	0.66
R7216:Ripor2	UTSW	13	24,855,886 (GRCm39)	missense	probably damaging	1.00
R7248:Ripor2	UTSW	13	24,878,128 (GRCm39)	missense	probably damaging	1.00
R7299:Ripor2	UTSW	13	24,908,984 (GRCm39)	missense	possibly damaging	0.54
R7301:Ripor2	UTSW	13	24,908,984 (GRCm39)	missense	possibly damaging	0.54
R7343:Ripor2	UTSW	13	24,885,427 (GRCm39)	nonsense	probably null
R7417:Ripor2	UTSW	13	24,880,533 (GRCm39)	missense	probably damaging	1.00
R7426:Ripor2	UTSW	13	24,878,188 (GRCm39)	missense	probably benign	0.01
R7448:Ripor2	UTSW	13	24,854,054 (GRCm39)	missense	possibly damaging	0.71
R7462:Ripor2	UTSW	13	24,880,290 (GRCm39)	missense	unknown
R7499:Ripor2	UTSW	13	24,877,755 (GRCm39)	missense	probably damaging	0.99
R8081:Ripor2	UTSW	13	24,897,683 (GRCm39)	missense	probably benign	0.01
R8157:Ripor2	UTSW	13	24,879,600 (GRCm39)	missense	probably benign	0.05
R8364:Ripor2	UTSW	13	24,894,176 (GRCm39)	missense	possibly damaging	0.95
R8447:Ripor2	UTSW	13	24,907,771 (GRCm39)	missense	probably damaging	1.00
R8465:Ripor2	UTSW	13	24,849,451 (GRCm39)	intron	probably benign
R8751:Ripor2	UTSW	13	24,885,050 (GRCm39)	missense	possibly damaging	0.69
R8818:Ripor2	UTSW	13	24,901,651 (GRCm39)	missense	possibly damaging	0.93
R8867:Ripor2	UTSW	13	24,822,760 (GRCm39)	intron	probably benign
R9079:Ripor2	UTSW	13	24,915,637 (GRCm39)	missense	probably benign	0.35
R9187:Ripor2	UTSW	13	24,897,632 (GRCm39)	missense	probably benign	0.01
R9316:Ripor2	UTSW	13	24,905,719 (GRCm39)	missense	probably benign	0.09
R9320:Ripor2	UTSW	13	24,915,663 (GRCm39)	missense	probably damaging	1.00
R9355:Ripor2	UTSW	13	24,885,694 (GRCm39)	missense	probably benign	0.00
R9655:Ripor2	UTSW	13	24,908,983 (GRCm39)	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TCTGCTTTCACTGAAGACATGC -3'
(R):5'- GAATTCTCAGCAATCCTCCTGC -3'

Sequencing Primer
(F):5'- GCTTTCACTGAAGACATGCATGAC -3'
(R):5'- CTTTAGCTAGGATTAGAGCCCAGC -3'

Posted On

2015-07-06