Mutagenetix > Incidental Mutation

Incidental Mutation 'R4365:Ripor2'

325715

Institutional Source

Beutler Lab

Gene Symbol

Ripor2

Ensembl Gene

ENSMUSG00000036006

Gene Name

RHO family interacting cell polarization regulator 2

Synonyms

1700108N18Rik, E430013J17Rik, Fam65b, 6330500D04Rik

MMRRC Submission

041113-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R4365 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24685513-24917789 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24905694 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 947 (P947S)

Ref Sequence

ENSEMBL: ENSMUSP00000106013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110383] [ENSMUST00000110384]

AlphaFold

Q80U16

Predicted Effect

probably benign
Transcript: ENSMUST00000110383
AA Change: P922S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: P922S

Domain	Start	End	E-Value	Type
coiled coil region	83	112	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	630	639	N/A	INTRINSIC
low complexity region	657	672	N/A	INTRINSIC
low complexity region	857	864	N/A	INTRINSIC
SCOP:d1gw5a_	901	1023	2e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110384
AA Change: P947S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: P947S

Domain	Start	End	E-Value	Type
Pfam:PL48	41	389	6e-174	PFAM
low complexity region	461	476	N/A	INTRINSIC
low complexity region	655	664	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	882	889	N/A	INTRINSIC
SCOP:d1gw5a_	926	1048	2e-9	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apob	A	T	12: 8,066,083 (GRCm39)	I4318F	possibly damaging	Het
Btrc	G	A	19: 45,501,919 (GRCm39)	D213N	probably damaging	Het
C4b	T	A	17: 34,953,717 (GRCm39)	I964F	possibly damaging	Het
Cacna1f	G	T	X: 7,476,213 (GRCm39)	A123S	probably damaging	Het
Ccdc153	G	A	9: 44,154,889 (GRCm39)	A71T	probably damaging	Het
Celsr3	C	A	9: 108,707,046 (GRCm39)	D1176E	possibly damaging	Het
Cfap46	A	C	7: 139,230,868 (GRCm39)	V920G	probably damaging	Het
Cnot10	T	A	9: 114,460,949 (GRCm39)	K74*	probably null	Het
Dnajb12	T	C	10: 59,715,588 (GRCm39)	F30S	probably damaging	Het
Emilin3	T	C	2: 160,750,406 (GRCm39)	R401G	probably benign	Het
F5	A	G	1: 164,012,519 (GRCm39)	T478A	probably damaging	Het
Hspa4l	C	A	3: 40,721,241 (GRCm39)		probably null	Het
Il1rl2	G	T	1: 40,390,951 (GRCm39)	R298L	probably benign	Het
Lipo2	A	T	19: 33,699,108 (GRCm39)	S307R	probably damaging	Het
Lrit2	T	A	14: 36,794,076 (GRCm39)	L380Q	probably damaging	Het
Ncan	A	G	8: 70,567,861 (GRCm39)	S84P	probably damaging	Het
Ncoa2	T	C	1: 13,250,771 (GRCm39)	I304V	probably damaging	Het
Nfe2l2	T	C	2: 75,509,772 (GRCm39)	D16G	probably damaging	Het
Nt5dc1	T	C	10: 34,186,377 (GRCm39)	D397G	probably benign	Het
Obsl1	A	C	1: 75,464,693 (GRCm39)	L1576R	possibly damaging	Het
Or5p1	A	T	7: 107,916,313 (GRCm39)	I71F	probably benign	Het
Or5v1	T	C	17: 37,810,270 (GRCm39)	S243P	probably damaging	Het
Or6c212	A	G	10: 129,559,281 (GRCm39)	I44T	probably damaging	Het
Pcdh17	A	G	14: 84,685,726 (GRCm39)	E731G	probably damaging	Het
Rag1	T	A	2: 101,473,288 (GRCm39)	K618M	probably damaging	Het
Rnf150	A	G	8: 83,590,744 (GRCm39)	K36E	probably benign	Het
S100a9	T	C	3: 90,600,081 (GRCm39)	H105R	unknown	Het
Spindoc	T	C	19: 7,351,219 (GRCm39)	D246G	possibly damaging	Het
St8sia4	A	T	1: 95,519,517 (GRCm39)	Y324N	possibly damaging	Het
Tlr11	T	A	14: 50,598,926 (GRCm39)	I304N	probably damaging	Het
Trpm3	A	G	19: 22,955,694 (GRCm39)	T1090A	probably benign	Het
Ube4a	T	C	9: 44,871,379 (GRCm39)	N7D	probably damaging	Het

Other mutations in Ripor2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ripor2	APN	13	24,885,190 (GRCm39)	missense	probably benign	0.11
IGL02145:Ripor2	APN	13	24,901,554 (GRCm39)	missense	probably damaging	1.00
IGL02351:Ripor2	APN	13	24,915,572 (GRCm39)	missense	probably damaging	1.00
IGL02358:Ripor2	APN	13	24,915,572 (GRCm39)	missense	probably damaging	1.00
IGL02377:Ripor2	APN	13	24,879,549 (GRCm39)	splice site	probably benign
IGL02533:Ripor2	APN	13	24,885,378 (GRCm39)	nonsense	probably null
IGL02798:Ripor2	APN	13	24,858,649 (GRCm39)	missense	probably damaging	0.99
IGL02852:Ripor2	APN	13	24,879,681 (GRCm39)	missense	probably damaging	1.00
IGL02869:Ripor2	APN	13	24,880,512 (GRCm39)	missense	possibly damaging	0.46
IGL03219:Ripor2	APN	13	24,907,702 (GRCm39)	missense	probably damaging	1.00
gentleman	UTSW	13	24,878,128 (GRCm39)	missense	probably damaging	1.00
Jack	UTSW	13	24,861,824 (GRCm39)	nonsense	probably null
whitechapel	UTSW	13	24,857,095 (GRCm39)	critical splice donor site	probably null
R0045:Ripor2	UTSW	13	24,878,209 (GRCm39)	missense	probably damaging	1.00
R0101:Ripor2	UTSW	13	24,864,615 (GRCm39)	missense	probably damaging	1.00
R0731:Ripor2	UTSW	13	24,864,627 (GRCm39)	missense	probably damaging	1.00
R0827:Ripor2	UTSW	13	24,878,169 (GRCm39)	missense	probably damaging	1.00
R1331:Ripor2	UTSW	13	24,861,824 (GRCm39)	nonsense	probably null
R1374:Ripor2	UTSW	13	24,857,095 (GRCm39)	critical splice donor site	probably null
R1564:Ripor2	UTSW	13	24,859,768 (GRCm39)	missense	probably damaging	1.00
R1773:Ripor2	UTSW	13	24,885,237 (GRCm39)	missense	probably benign	0.10
R1889:Ripor2	UTSW	13	24,877,870 (GRCm39)	missense	probably damaging	1.00
R2122:Ripor2	UTSW	13	24,897,701 (GRCm39)	missense	probably damaging	0.98
R2137:Ripor2	UTSW	13	24,905,817 (GRCm39)	critical splice donor site	probably null
R2209:Ripor2	UTSW	13	24,885,595 (GRCm39)	missense	probably damaging	1.00
R2242:Ripor2	UTSW	13	24,855,755 (GRCm39)	missense	probably benign	0.08
R2392:Ripor2	UTSW	13	24,890,206 (GRCm39)	missense	probably benign	0.00
R2994:Ripor2	UTSW	13	24,885,610 (GRCm39)	missense	probably damaging	0.98
R4008:Ripor2	UTSW	13	24,880,521 (GRCm39)	missense	probably benign
R4287:Ripor2	UTSW	13	24,908,992 (GRCm39)	missense	probably damaging	1.00
R4364:Ripor2	UTSW	13	24,905,694 (GRCm39)	missense	probably benign	0.07
R4366:Ripor2	UTSW	13	24,905,694 (GRCm39)	missense	probably benign	0.07
R4868:Ripor2	UTSW	13	24,878,124 (GRCm39)	missense	possibly damaging	0.88
R5304:Ripor2	UTSW	13	24,858,649 (GRCm39)	missense	probably damaging	0.99
R6119:Ripor2	UTSW	13	24,798,627 (GRCm39)	start gained	probably benign
R6157:Ripor2	UTSW	13	24,885,052 (GRCm39)	missense	probably damaging	1.00
R6178:Ripor2	UTSW	13	24,894,113 (GRCm39)	missense	possibly damaging	0.94
R6382:Ripor2	UTSW	13	24,861,828 (GRCm39)	missense	possibly damaging	0.89
R6664:Ripor2	UTSW	13	24,859,803 (GRCm39)	missense	probably damaging	0.98
R6908:Ripor2	UTSW	13	24,890,215 (GRCm39)	missense	probably damaging	1.00
R7023:Ripor2	UTSW	13	24,855,829 (GRCm39)	missense	probably benign	0.00
R7041:Ripor2	UTSW	13	24,877,749 (GRCm39)	missense	probably benign	0.18
R7196:Ripor2	UTSW	13	24,888,808 (GRCm39)	missense	possibly damaging	0.66
R7216:Ripor2	UTSW	13	24,855,886 (GRCm39)	missense	probably damaging	1.00
R7248:Ripor2	UTSW	13	24,878,128 (GRCm39)	missense	probably damaging	1.00
R7299:Ripor2	UTSW	13	24,908,984 (GRCm39)	missense	possibly damaging	0.54
R7301:Ripor2	UTSW	13	24,908,984 (GRCm39)	missense	possibly damaging	0.54
R7343:Ripor2	UTSW	13	24,885,427 (GRCm39)	nonsense	probably null
R7417:Ripor2	UTSW	13	24,880,533 (GRCm39)	missense	probably damaging	1.00
R7426:Ripor2	UTSW	13	24,878,188 (GRCm39)	missense	probably benign	0.01
R7448:Ripor2	UTSW	13	24,854,054 (GRCm39)	missense	possibly damaging	0.71
R7462:Ripor2	UTSW	13	24,880,290 (GRCm39)	missense	unknown
R7499:Ripor2	UTSW	13	24,877,755 (GRCm39)	missense	probably damaging	0.99
R8081:Ripor2	UTSW	13	24,897,683 (GRCm39)	missense	probably benign	0.01
R8157:Ripor2	UTSW	13	24,879,600 (GRCm39)	missense	probably benign	0.05
R8364:Ripor2	UTSW	13	24,894,176 (GRCm39)	missense	possibly damaging	0.95
R8447:Ripor2	UTSW	13	24,907,771 (GRCm39)	missense	probably damaging	1.00
R8465:Ripor2	UTSW	13	24,849,451 (GRCm39)	intron	probably benign
R8751:Ripor2	UTSW	13	24,885,050 (GRCm39)	missense	possibly damaging	0.69
R8818:Ripor2	UTSW	13	24,901,651 (GRCm39)	missense	possibly damaging	0.93
R8867:Ripor2	UTSW	13	24,822,760 (GRCm39)	intron	probably benign
R9079:Ripor2	UTSW	13	24,915,637 (GRCm39)	missense	probably benign	0.35
R9187:Ripor2	UTSW	13	24,897,632 (GRCm39)	missense	probably benign	0.01
R9316:Ripor2	UTSW	13	24,905,719 (GRCm39)	missense	probably benign	0.09
R9320:Ripor2	UTSW	13	24,915,663 (GRCm39)	missense	probably damaging	1.00
R9355:Ripor2	UTSW	13	24,885,694 (GRCm39)	missense	probably benign	0.00
R9655:Ripor2	UTSW	13	24,908,983 (GRCm39)	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TCTGCTTTCACTGAAGACATGC -3'
(R):5'- GAATTCTCAGCAATCCTCCTGC -3'

Sequencing Primer
(F):5'- GCTTTCACTGAAGACATGCATGAC -3'
(R):5'- CTTTAGCTAGGATTAGAGCCCAGC -3'

Posted On

2015-07-06