Incidental Mutation 'R0012:Dock2'
ID32575
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 038307-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0012 (G1)
Quality Score137
Status Validated
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34783795 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 10 (E10G)
Ref Sequence ENSEMBL: ENSMUSP00000098916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193] [ENSMUST00000101365] [ENSMUST00000143540]
Predicted Effect probably benign
Transcript: ENSMUST00000093193
AA Change: E10G

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: E10G

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101365
AA Change: E10G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143
AA Change: E10G

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143540
AA Change: E10G

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116893
Gene: ENSMUSG00000020143
AA Change: E10G

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK-C2 418 617 1.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154178
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A T 2: 131,052,920 L687Q probably damaging Het
Adap1 A G 5: 139,307,734 probably benign Het
Add2 T A 6: 86,098,628 V253E probably damaging Het
Agtr1a A T 13: 30,381,749 I266F probably damaging Het
Anxa9 A G 3: 95,308,095 probably benign Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Asna1 T C 8: 85,025,096 probably benign Het
Bnip3 A G 7: 138,898,672 probably benign Het
Brwd1 A C 16: 96,059,652 S311R probably damaging Het
C2cd3 G A 7: 100,418,522 V871M possibly damaging Het
Cacul1 A G 19: 60,564,253 W145R probably damaging Het
Celf5 C A 10: 81,469,512 V141L probably damaging Het
Cfap206 C A 4: 34,714,519 L392F possibly damaging Het
Chd2 G T 7: 73,455,519 T192K probably damaging Het
Chrna10 T C 7: 102,115,057 N40S possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clspn T A 4: 126,564,929 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col5a3 A T 9: 20,777,108 probably benign Het
Copb1 T A 7: 114,237,408 K366N probably damaging Het
Cul9 G A 17: 46,538,510 R570C probably benign Het
Cyp2c70 A T 19: 40,187,243 L7Q probably null Het
Dpysl4 T G 7: 139,097,883 I412S probably benign Het
Eaf2 T A 16: 36,808,174 probably benign Het
Fasl T C 1: 161,788,164 D41G probably benign Het
Fat2 A G 11: 55,262,871 V3505A probably benign Het
Fbxo24 A G 5: 137,621,994 F101S probably damaging Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Gcnt3 T C 9: 70,034,085 I400M probably benign Het
Gpd2 T A 2: 57,338,868 M228K probably damaging Het
Gsap T A 5: 21,226,229 probably benign Het
Hipk1 A G 3: 103,763,680 M467T probably damaging Het
Hmgb4 T A 4: 128,260,725 I17F probably damaging Het
Ints10 C A 8: 68,807,475 L284M probably benign Het
Kif17 T G 4: 138,293,748 S606A probably damaging Het
Lifr C A 15: 7,175,608 T442K possibly damaging Het
Lypd4 A G 7: 24,865,332 L127P probably damaging Het
Lyst A G 13: 13,687,694 H2605R probably benign Het
Map3k4 A G 17: 12,238,189 S1289P probably damaging Het
Mgam T A 6: 40,765,256 probably null Het
Mob1b G A 5: 88,756,084 probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Ms4a4c C A 19: 11,418,980 probably benign Het
Mthfd2l A T 5: 90,961,383 H224L probably damaging Het
Myh8 T C 11: 67,300,021 Y1350H probably benign Het
Nectin2 T C 7: 19,730,744 probably benign Het
Nos1 A C 5: 117,893,902 N305T probably damaging Het
Ogfrl1 T A 1: 23,370,125 Q340L possibly damaging Het
Olfr1318 A T 2: 112,156,826 N292Y possibly damaging Het
Olfr1502 C A 19: 13,861,823 T10K probably damaging Het
Olfr170 T C 16: 19,606,440 N76S probably benign Het
Olfr427 T G 1: 174,100,207 F250V probably damaging Het
Orc1 T C 4: 108,595,646 probably null Het
Plekhg5 C A 4: 152,104,750 D249E probably benign Het
Plet1 A G 9: 50,499,130 I74V probably benign Het
Psmd2 T A 16: 20,661,684 D718E probably damaging Het
Rab33b G T 3: 51,484,316 probably benign Het
Rae1 T A 2: 173,002,673 F4I unknown Het
Ralgapa2 A G 2: 146,412,752 Y821H probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sharpin G T 15: 76,348,343 P156T possibly damaging Het
Slc38a4 C T 15: 96,999,629 R435H probably damaging Het
Snrnp200 T C 2: 127,228,549 V1061A probably benign Het
Suclg1 A G 6: 73,270,997 T234A possibly damaging Het
Swsap1 T C 9: 21,957,022 C197R probably benign Het
Tbx15 A G 3: 99,352,096 T428A probably benign Het
Tet2 T C 3: 133,476,558 Y1215C probably damaging Het
Tjp1 A G 7: 65,329,775 probably benign Het
Tmem209 G T 6: 30,502,113 probably benign Het
Tnpo3 T C 6: 29,589,177 E58G probably damaging Het
Trp53bp2 T A 1: 182,444,718 M464K probably damaging Het
Ttc32 A G 12: 9,035,897 Y148C possibly damaging Het
Unc80 T C 1: 66,507,391 S541P probably damaging Het
Ushbp1 T C 8: 71,395,040 probably benign Het
Vmn2r100 A G 17: 19,504,874 M22V probably benign Het
Vmn2r100 A T 17: 19,526,034 E485V probably damaging Het
Wdr24 G A 17: 25,827,113 V471I probably benign Het
Zfp35 T A 18: 24,002,944 M115K probably benign Het
Zfp429 G A 13: 67,390,677 S216L probably benign Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
pier UTSW 11 34689766 missense probably damaging 1.00
plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAAGCACTGCGTTCCAGACC -3'
(R):5'- AGCGTGTCACTCACTGAGTACAGG -3'

Sequencing Primer
(F):5'- CTGCGTTCCAGACCATAAGTTAG -3'
(R):5'- aggaaaagcaggtgaaggg -3'
Posted On2013-05-09