Incidental Mutation 'R4366:Mypn'
ID325759
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Namemyopalladin
Synonyms1110056A04Rik
MMRRC Submission 041114-MU
Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63115795-63203952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63192708 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 192 (E192G)
Ref Sequence ENSEMBL: ENSMUSP00000093240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580]
Predicted Effect probably benign
Transcript: ENSMUST00000095580
AA Change: E192G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: E192G

DomainStartEndE-ValueType
low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63192423 missense probably damaging 1.00
IGL01137:Mypn APN 10 63152854 missense probably benign 0.12
IGL01383:Mypn APN 10 63135797 missense probably damaging 1.00
IGL01560:Mypn APN 10 63134964 missense probably benign 0.27
IGL01569:Mypn APN 10 63127759 missense probably damaging 1.00
IGL02197:Mypn APN 10 63123278 missense possibly damaging 0.69
IGL02829:Mypn APN 10 63192586 missense probably benign 0.01
IGL03221:Mypn APN 10 63131123 missense probably damaging 1.00
IGL03377:Mypn APN 10 63192865 missense probably benign 0.01
2107:Mypn UTSW 10 63203751 utr 5 prime probably benign
PIT4576001:Mypn UTSW 10 63120071 missense probably damaging 1.00
R0115:Mypn UTSW 10 63192380 splice site probably benign
R0377:Mypn UTSW 10 63127622 unclassified probably benign
R0480:Mypn UTSW 10 63193203 missense probably benign 0.01
R0581:Mypn UTSW 10 63162244 missense probably benign 0.06
R0669:Mypn UTSW 10 63134923 splice site probably benign
R0822:Mypn UTSW 10 63169256 missense probably damaging 1.00
R1209:Mypn UTSW 10 63118499 missense probably damaging 1.00
R1401:Mypn UTSW 10 63152857 missense probably damaging 0.96
R1513:Mypn UTSW 10 63169368 missense probably damaging 0.99
R1750:Mypn UTSW 10 63136197 missense probably benign 0.01
R1780:Mypn UTSW 10 63121964 missense probably damaging 1.00
R1791:Mypn UTSW 10 63125693 missense probably damaging 0.97
R1859:Mypn UTSW 10 63146190 missense probably benign
R1903:Mypn UTSW 10 63123397 missense probably benign 0.06
R2275:Mypn UTSW 10 63131069 missense probably damaging 1.00
R2420:Mypn UTSW 10 63192869 nonsense probably null
R3425:Mypn UTSW 10 63118417 splice site probably benign
R3767:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3768:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3770:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3777:Mypn UTSW 10 63147982 missense possibly damaging 0.92
R3785:Mypn UTSW 10 63193182 missense probably benign 0.43
R3888:Mypn UTSW 10 63192510 missense probably damaging 1.00
R4289:Mypn UTSW 10 63131182 missense probably damaging 1.00
R4301:Mypn UTSW 10 63118484 missense probably damaging 1.00
R4459:Mypn UTSW 10 63192432 missense probably damaging 1.00
R4921:Mypn UTSW 10 63147936 missense possibly damaging 0.75
R4995:Mypn UTSW 10 63119968 intron probably null
R5064:Mypn UTSW 10 63123371 missense possibly damaging 0.68
R5083:Mypn UTSW 10 63118528 missense probably damaging 0.98
R5108:Mypn UTSW 10 63136294 missense probably damaging 1.00
R5399:Mypn UTSW 10 63120186 missense probably benign 0.03
R5438:Mypn UTSW 10 63135839 nonsense probably null
R5590:Mypn UTSW 10 63120048 missense probably benign 0.27
R5652:Mypn UTSW 10 63135801 missense probably damaging 1.00
R5717:Mypn UTSW 10 63127776 missense probably damaging 1.00
R5970:Mypn UTSW 10 63131023 missense probably benign 0.36
R6616:Mypn UTSW 10 63169312 missense probably damaging 1.00
R6930:Mypn UTSW 10 63116939 missense probably damaging 1.00
R6987:Mypn UTSW 10 63193131 missense probably benign 0.00
R7020:Mypn UTSW 10 63192510 missense probably damaging 1.00
R7081:Mypn UTSW 10 63134958 missense probably damaging 1.00
R7477:Mypn UTSW 10 63125721 missense possibly damaging 0.89
R7534:Mypn UTSW 10 63193131 missense probably benign 0.00
X0022:Mypn UTSW 10 63136063 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGTAACTTTTGTGTGAAGCGG -3'
(R):5'- CCGCAGTACAGTTCTGAAACC -3'

Sequencing Primer
(F):5'- CCCAGAGGCTCTTCGTAGTATAG -3'
(R):5'- CCAGTCCAAGAAAGTTTTCCTG -3'
Posted On2015-07-06