Incidental Mutation 'R4367:Suco'
ID325783
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene NameSUN domain containing ossification factor
SynonymsAI848100, Opt, osteopotentia
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161816114-161876682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 161847230 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 416 (E416G)
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377]
Predicted Effect probably damaging
Transcript: ENSMUST00000048377
AA Change: E416G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297
AA Change: E416G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192570
AA Change: E141G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194388
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161834120 missense probably damaging 1.00
IGL01688:Suco APN 1 161863911 splice site probably null
IGL01794:Suco APN 1 161827725 missense probably benign 0.01
IGL01891:Suco APN 1 161838802 missense probably damaging 1.00
IGL02028:Suco APN 1 161856859 missense possibly damaging 0.95
IGL02102:Suco APN 1 161827705 missense probably damaging 1.00
IGL02351:Suco APN 1 161818626 missense probably benign 0.35
IGL02358:Suco APN 1 161818626 missense probably benign 0.35
IGL02392:Suco APN 1 161834567 missense probably benign 0.11
IGL02638:Suco APN 1 161827687 missense probably damaging 1.00
IGL02650:Suco APN 1 161848753 splice site probably benign
IGL03106:Suco APN 1 161834480 missense possibly damaging 0.91
IGL03189:Suco APN 1 161857337 unclassified probably benign
IGL03328:Suco APN 1 161820421 missense probably damaging 0.99
3-1:Suco UTSW 1 161822031 intron probably benign
H8562:Suco UTSW 1 161852851 missense probably damaging 1.00
H8786:Suco UTSW 1 161852851 missense probably damaging 1.00
R0023:Suco UTSW 1 161845585 splice site probably null
R0023:Suco UTSW 1 161845585 splice site probably null
R0179:Suco UTSW 1 161876305 splice site probably benign
R0299:Suco UTSW 1 161853810 missense probably benign
R0418:Suco UTSW 1 161834850 missense probably benign 0.11
R0481:Suco UTSW 1 161862313 unclassified probably benign
R0610:Suco UTSW 1 161859503 missense probably benign
R0610:Suco UTSW 1 161864032 splice site probably benign
R0634:Suco UTSW 1 161838804 missense possibly damaging 0.77
R0645:Suco UTSW 1 161834114 missense probably damaging 1.00
R1276:Suco UTSW 1 161857456 missense probably benign 0.10
R1720:Suco UTSW 1 161834054 missense probably damaging 1.00
R1739:Suco UTSW 1 161827655 critical splice donor site probably null
R1763:Suco UTSW 1 161834949 missense possibly damaging 0.80
R1835:Suco UTSW 1 161859500 nonsense probably null
R1988:Suco UTSW 1 161818811 critical splice acceptor site probably null
R2939:Suco UTSW 1 161848651 missense probably damaging 1.00
R3773:Suco UTSW 1 161843996 splice site probably null
R3882:Suco UTSW 1 161834744 missense probably benign 0.33
R4193:Suco UTSW 1 161863959 missense probably benign 0.32
R4397:Suco UTSW 1 161844852 missense probably damaging 1.00
R4846:Suco UTSW 1 161834408 missense possibly damaging 0.65
R4851:Suco UTSW 1 161834192 missense probably damaging 1.00
R5224:Suco UTSW 1 161834705 missense probably benign 0.06
R5329:Suco UTSW 1 161833430 missense probably damaging 0.99
R6133:Suco UTSW 1 161835183 nonsense probably null
R6632:Suco UTSW 1 161828240 missense possibly damaging 0.86
R6643:Suco UTSW 1 161859432 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACAAGACTTGTAACTTGGAGCTTG -3'
(R):5'- AAGTAATTCTTTCCCAGTGAAGTGG -3'

Sequencing Primer
(F):5'- ACTTGGAGCTTGTTAAAATAGTTTGG -3'
(R):5'- TTCCCAGTGAAGTGGAACTC -3'
Posted On2015-07-06