Incidental Mutation 'R4367:B4galt3'
ID325785
Institutional Source Beutler Lab
Gene Symbol B4galt3
Ensembl Gene ENSMUSG00000052423
Gene NameUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms9530061M23Rik, R74981, ESTM26, beta4GalT-III
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171270328-171276896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 171274043 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 196 (H196N)
Ref Sequence ENSEMBL: ENSMUSP00000106945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141114] [ENSMUST00000141999] [ENSMUST00000151863] [ENSMUST00000192956]
Predicted Effect probably damaging
Transcript: ENSMUST00000064272
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111313
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125939
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138904
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141999
SMART Domains Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in B4galt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:B4galt3 APN 1 171271792 missense probably damaging 1.00
R0026:B4galt3 UTSW 1 171274261 unclassified probably benign
R0126:B4galt3 UTSW 1 171276165 missense probably damaging 0.97
R0537:B4galt3 UTSW 1 171274251 unclassified probably benign
R1478:B4galt3 UTSW 1 171276365 missense probably benign 0.11
R2012:B4galt3 UTSW 1 171272548 missense probably damaging 1.00
R2206:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2207:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2223:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2353:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2354:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2438:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2439:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3039:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3051:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3709:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3710:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3741:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3742:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3813:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3953:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4058:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4059:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4323:B4galt3 UTSW 1 171275942 missense possibly damaging 0.93
R4368:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4370:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4371:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4486:B4galt3 UTSW 1 171271773 missense possibly damaging 0.94
R4538:B4galt3 UTSW 1 171272710 missense probably damaging 1.00
R5557:B4galt3 UTSW 1 171272519 critical splice acceptor site probably null
R7313:B4galt3 UTSW 1 171272749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGGGTGCTCTCTTCA -3'
(R):5'- CTCCGCCAAAGTACTGGGG -3'

Sequencing Primer
(F):5'- GGGTGCTCTCTTCACTTTGGC -3'
(R):5'- AGATCCCTGCGGTTCACAAATTTG -3'
Posted On2015-07-06