Incidental Mutation 'R4367:Prpf38b'
ID325790
Institutional Source Beutler Lab
Gene Symbol Prpf38b
Ensembl Gene ENSMUSG00000027881
Gene NamePRP38 pre-mRNA processing factor 38 (yeast) domain containing B
Synonyms
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108902805-108911727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108911171 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 91 (Y91C)
Ref Sequence ENSEMBL: ENSMUSP00000142929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029480] [ENSMUST00000129273] [ENSMUST00000199735]
Predicted Effect probably damaging
Transcript: ENSMUST00000029480
AA Change: Y91C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029480
Gene: ENSMUSG00000027881
AA Change: Y91C

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 48 232 5.4e-59 PFAM
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 291 N/A INTRINSIC
coiled coil region 293 322 N/A INTRINSIC
low complexity region 400 439 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
low complexity region 480 506 N/A INTRINSIC
low complexity region 510 534 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129273
AA Change: Y91C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143724
Gene: ENSMUSG00000027881
AA Change: Y91C

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 48 93 2.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197805
Predicted Effect probably damaging
Transcript: ENSMUST00000199735
AA Change: Y91C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142929
Gene: ENSMUSG00000027881
AA Change: Y91C

DomainStartEndE-ValueType
low complexity region 13 35 N/A INTRINSIC
Pfam:PRP38 43 150 2e-16 PFAM
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Prpf38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Prpf38b APN 3 108904675 missense probably benign 0.23
IGL03145:Prpf38b APN 3 108903945 utr 3 prime probably benign
IGL03269:Prpf38b APN 3 108905241 missense probably benign 0.23
R0482:Prpf38b UTSW 3 108905270 missense probably damaging 1.00
R0765:Prpf38b UTSW 3 108911418 missense possibly damaging 0.53
R3724:Prpf38b UTSW 3 108904340 utr 3 prime probably benign
R3934:Prpf38b UTSW 3 108904425 utr 3 prime probably benign
R4649:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R4651:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R4653:Prpf38b UTSW 3 108904092 utr 3 prime probably benign
R5073:Prpf38b UTSW 3 108911168 missense probably damaging 1.00
R6795:Prpf38b UTSW 3 108904664 utr 3 prime probably benign
R6979:Prpf38b UTSW 3 108911324 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAAGATCGATTGTGGCGGG -3'
(R):5'- AAGAGATCGAGCTCCTCTGCTG -3'

Sequencing Primer
(F):5'- GGCTCGCCCGGCTATTAAAAC -3'
(R):5'- ACGGCCTTCCATGGAGTAG -3'
Posted On2015-07-06