Incidental Mutation 'R4367:Dnttip2'
ID325791
Institutional Source Beutler Lab
Gene Symbol Dnttip2
Ensembl Gene ENSMUSG00000039756
Gene Namedeoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms4930588M11Rik
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122274388-122285271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122276497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 454 (S454P)
Ref Sequence ENSEMBL: ENSMUSP00000045043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035776]
Predicted Effect probably damaging
Transcript: ENSMUST00000035776
AA Change: S454P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: S454P

DomainStartEndE-ValueType
low complexity region 125 143 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
coiled coil region 513 541 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Pfam:Fcf2 639 733 3.4e-41 PFAM
low complexity region 748 756 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199627
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Dnttip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Dnttip2 APN 3 122284499 missense probably damaging 1.00
IGL00921:Dnttip2 APN 3 122275290 missense probably benign 0.03
IGL01120:Dnttip2 APN 3 122278737 splice site probably benign
IGL01341:Dnttip2 APN 3 122276612 missense probably damaging 1.00
IGL01636:Dnttip2 APN 3 122282474 missense possibly damaging 0.95
IGL01988:Dnttip2 APN 3 122276295 missense probably benign 0.05
IGL02096:Dnttip2 APN 3 122284413 missense possibly damaging 0.51
IGL02216:Dnttip2 APN 3 122276261 missense probably benign 0.01
IGL03234:Dnttip2 APN 3 122282438 missense probably damaging 1.00
abyss UTSW 3 122276221 missense probably damaging 0.99
chasm UTSW 3 122275808 missense probably damaging 1.00
R0089:Dnttip2 UTSW 3 122275462 missense possibly damaging 0.59
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0195:Dnttip2 UTSW 3 122276161 missense probably benign 0.02
R1103:Dnttip2 UTSW 3 122276422 missense probably benign 0.02
R1733:Dnttip2 UTSW 3 122276748 missense probably benign 0.25
R1759:Dnttip2 UTSW 3 122276149 missense probably benign 0.21
R2019:Dnttip2 UTSW 3 122280744 missense possibly damaging 0.93
R2022:Dnttip2 UTSW 3 122276221 missense probably damaging 1.00
R2415:Dnttip2 UTSW 3 122276537 missense probably damaging 1.00
R3913:Dnttip2 UTSW 3 122275391 missense possibly damaging 0.68
R4194:Dnttip2 UTSW 3 122280761 missense probably damaging 1.00
R4871:Dnttip2 UTSW 3 122285101 missense probably damaging 1.00
R4888:Dnttip2 UTSW 3 122276592 missense probably damaging 1.00
R5082:Dnttip2 UTSW 3 122275941 missense probably damaging 0.98
R5436:Dnttip2 UTSW 3 122278769 missense probably damaging 1.00
R5483:Dnttip2 UTSW 3 122276797 missense probably damaging 0.97
R5933:Dnttip2 UTSW 3 122275568 missense probably benign 0.07
R5966:Dnttip2 UTSW 3 122285168 utr 3 prime probably benign
R6171:Dnttip2 UTSW 3 122278862 missense probably damaging 0.99
R6251:Dnttip2 UTSW 3 122275256 missense probably benign 0.14
R6286:Dnttip2 UTSW 3 122284400 missense probably damaging 1.00
R6512:Dnttip2 UTSW 3 122275523 missense possibly damaging 0.67
R6519:Dnttip2 UTSW 3 122275471 missense probably benign 0.05
R6670:Dnttip2 UTSW 3 122276221 missense probably damaging 0.99
R6833:Dnttip2 UTSW 3 122276803 missense probably damaging 0.99
R6870:Dnttip2 UTSW 3 122275808 missense probably damaging 1.00
R6969:Dnttip2 UTSW 3 122282492 missense probably damaging 1.00
R7038:Dnttip2 UTSW 3 122276532 nonsense probably null
R7233:Dnttip2 UTSW 3 122276390 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAGAGTGACTTGGCACAGCTC -3'
(R):5'- CCTCAATAGCAACTTCACTCGG -3'

Sequencing Primer
(F):5'- ACTTGGCACAGCTCGGTGG -3'
(R):5'- ATAGCAACTTCACTCGGAGCCTTG -3'
Posted On2015-07-06