Incidental Mutation 'R4367:Tle1'
ID325793
Institutional Source Beutler Lab
Gene Symbol Tle1
Ensembl Gene ENSMUSG00000008305
Gene Nametransducin-like enhancer of split 1
SynonymsC230057C06Rik, Estm14, Grg1, Tle4l
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R4367 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location72117142-72200919 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) ACAGGTTTCTTCAGGTTTCTT to ACAGGTTTCTT at 72118163 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030095] [ENSMUST00000072695] [ENSMUST00000074216] [ENSMUST00000102848]
Predicted Effect probably benign
Transcript: ENSMUST00000030095
SMART Domains Protein: ENSMUSP00000030095
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 9.1e-77 PFAM
low complexity region 155 183 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
WD40 484 521 4.18e-2 SMART
WD40 527 568 1.03e-1 SMART
WD40 573 612 9.38e-5 SMART
WD40 615 654 1.14e-8 SMART
WD40 657 695 3.07e1 SMART
WD40 697 736 8.96e-2 SMART
WD40 737 777 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072695
SMART Domains Protein: ENSMUSP00000072481
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.6e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074216
SMART Domains Protein: ENSMUSP00000073839
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 1.3e-78 PFAM
low complexity region 145 173 N/A INTRINSIC
low complexity region 230 245 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
WD40 474 511 4.18e-2 SMART
WD40 517 558 1.03e-1 SMART
WD40 563 602 9.38e-5 SMART
WD40 605 644 1.14e-8 SMART
WD40 647 685 3.07e1 SMART
WD40 687 726 8.96e-2 SMART
WD40 727 767 4.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102848
SMART Domains Protein: ENSMUSP00000099912
Gene: ENSMUSG00000008305

DomainStartEndE-ValueType
Pfam:TLE_N 1 144 1.3e-76 PFAM
low complexity region 153 181 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 290 312 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
WD40 481 518 4.18e-2 SMART
WD40 524 565 1.03e-1 SMART
WD40 570 609 9.38e-5 SMART
WD40 612 651 1.14e-8 SMART
WD40 654 692 3.07e1 SMART
WD40 694 733 8.96e-2 SMART
WD40 734 774 4.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132550
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Tle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tle1 APN 4 72169118 missense possibly damaging 0.94
IGL00972:Tle1 APN 4 72122400 missense probably damaging 1.00
IGL01548:Tle1 APN 4 72170718 missense probably damaging 1.00
IGL01737:Tle1 APN 4 72197821 splice site probably benign
IGL01798:Tle1 APN 4 72137148 missense probably damaging 1.00
IGL01943:Tle1 APN 4 72122402 missense probably damaging 1.00
PIT4515001:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R0140:Tle1 UTSW 4 72120185 missense probably damaging 1.00
R0544:Tle1 UTSW 4 72124990 missense probably damaging 1.00
R0603:Tle1 UTSW 4 72118347 missense probably damaging 1.00
R0729:Tle1 UTSW 4 72126442 splice site probably benign
R0786:Tle1 UTSW 4 72199361 missense probably damaging 1.00
R0939:Tle1 UTSW 4 72118534 missense probably damaging 1.00
R1297:Tle1 UTSW 4 72124838 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1465:Tle1 UTSW 4 72139831 missense probably damaging 1.00
R1512:Tle1 UTSW 4 72141258 missense probably damaging 1.00
R1967:Tle1 UTSW 4 72120226 missense probably damaging 1.00
R2218:Tle1 UTSW 4 72199319 missense possibly damaging 0.47
R3713:Tle1 UTSW 4 72126422 missense possibly damaging 0.70
R4379:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4380:Tle1 UTSW 4 72118163 utr 3 prime probably benign
R4655:Tle1 UTSW 4 72145344 missense possibly damaging 0.68
R4662:Tle1 UTSW 4 72137098 missense possibly damaging 0.92
R4731:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4732:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4733:Tle1 UTSW 4 72125019 missense possibly damaging 0.71
R4812:Tle1 UTSW 4 72145354 missense probably damaging 0.98
R5066:Tle1 UTSW 4 72158267 missense probably benign 0.24
R5288:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5386:Tle1 UTSW 4 72141844 missense probably damaging 1.00
R5405:Tle1 UTSW 4 72138971 intron probably benign
R5579:Tle1 UTSW 4 72139808 missense probably damaging 1.00
R5590:Tle1 UTSW 4 72124971 missense possibly damaging 0.91
R5762:Tle1 UTSW 4 72120135 splice site probably null
R6617:Tle1 UTSW 4 72141280 missense probably damaging 0.98
R6750:Tle1 UTSW 4 72122450 missense probably damaging 1.00
R7077:Tle1 UTSW 4 72158375 missense probably benign 0.25
R7153:Tle1 UTSW 4 72139061 missense probably benign 0.03
R7156:Tle1 UTSW 4 72170716 missense probably benign 0.15
R7266:Tle1 UTSW 4 72139687 critical splice donor site probably null
R7316:Tle1 UTSW 4 72118292 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGACACCACTGCTCTACAAAGG -3'
(R):5'- ACATAGTCACTGGCTCAGGG -3'

Sequencing Primer
(F):5'- CTGCTCTACAAAGGACTCAAGGTG -3'
(R):5'- GGACAAAAAGGCTACCGTTTATG -3'
Posted On2015-07-06