Incidental Mutation 'R4367:Vmn2r25'
ID325802
Institutional Source Beutler Lab
Gene Symbol Vmn2r25
Ensembl Gene ENSMUSG00000094672
Gene Namevomeronasal 2, receptor 25
SynonymsEG545874
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123822814-123853190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123828537 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 454 (R454G)
Ref Sequence ENSEMBL: ENSMUSP00000124342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162046]
Predicted Effect probably damaging
Transcript: ENSMUST00000162046
AA Change: R454G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124342
Gene: ENSMUSG00000094672
AA Change: R454G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 473 6e-31 PFAM
Pfam:NCD3G 519 572 5.8e-25 PFAM
Pfam:7tm_3 603 840 4.8e-55 PFAM
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Vmn2r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Vmn2r25 APN 6 123853171 missense probably benign 0.25
IGL01781:Vmn2r25 APN 6 123839365 missense possibly damaging 0.48
IGL01843:Vmn2r25 APN 6 123853003 missense possibly damaging 0.67
IGL02023:Vmn2r25 APN 6 123839429 missense probably damaging 0.96
IGL02502:Vmn2r25 APN 6 123839433 missense probably damaging 0.96
IGL02709:Vmn2r25 APN 6 123839764 missense possibly damaging 0.50
IGL03053:Vmn2r25 APN 6 123823118 missense probably damaging 1.00
PIT4468001:Vmn2r25 UTSW 6 123839598 missense probably benign 0.00
PIT4812001:Vmn2r25 UTSW 6 123823488 missense probably damaging 1.00
R0054:Vmn2r25 UTSW 6 123853025 missense probably benign 0.00
R0312:Vmn2r25 UTSW 6 123828580 splice site probably benign
R0366:Vmn2r25 UTSW 6 123823622 nonsense probably null
R0390:Vmn2r25 UTSW 6 123823181 missense probably damaging 1.00
R0466:Vmn2r25 UTSW 6 123852049 missense probably benign 0.16
R0541:Vmn2r25 UTSW 6 123839827 missense probably damaging 0.97
R0612:Vmn2r25 UTSW 6 123839522 missense probably damaging 1.00
R0865:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R1219:Vmn2r25 UTSW 6 123839323 missense probably benign 0.00
R1240:Vmn2r25 UTSW 6 123851905 missense probably damaging 0.98
R1701:Vmn2r25 UTSW 6 123851795 splice site probably null
R1780:Vmn2r25 UTSW 6 123828465 missense probably damaging 1.00
R1809:Vmn2r25 UTSW 6 123825378 missense probably benign 0.00
R1833:Vmn2r25 UTSW 6 123839684 missense probably benign 0.01
R1964:Vmn2r25 UTSW 6 123823295 missense possibly damaging 0.94
R2154:Vmn2r25 UTSW 6 123839846 missense probably benign 0.01
R2164:Vmn2r25 UTSW 6 123839559 missense possibly damaging 0.96
R3799:Vmn2r25 UTSW 6 123853184 missense probably benign 0.12
R3836:Vmn2r25 UTSW 6 123853085 missense probably damaging 1.00
R3946:Vmn2r25 UTSW 6 123840098 missense probably damaging 0.97
R4282:Vmn2r25 UTSW 6 123823647 missense probably damaging 1.00
R4438:Vmn2r25 UTSW 6 123839797 missense probably benign 0.03
R4488:Vmn2r25 UTSW 6 123822860 missense probably damaging 1.00
R4580:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.46
R4631:Vmn2r25 UTSW 6 123853003 missense possibly damaging 0.94
R4765:Vmn2r25 UTSW 6 123823223 missense probably damaging 1.00
R4908:Vmn2r25 UTSW 6 123828447 missense probably benign
R5207:Vmn2r25 UTSW 6 123840103 missense probably damaging 1.00
R5254:Vmn2r25 UTSW 6 123825318 missense probably damaging 1.00
R5444:Vmn2r25 UTSW 6 123828492 missense probably benign 0.00
R5586:Vmn2r25 UTSW 6 123825296 missense probably damaging 1.00
R5607:Vmn2r25 UTSW 6 123828359 missense possibly damaging 0.49
R5985:Vmn2r25 UTSW 6 123823628 missense probably benign
R6046:Vmn2r25 UTSW 6 123822917 missense probably damaging 1.00
R6057:Vmn2r25 UTSW 6 123822941 missense possibly damaging 0.69
R6569:Vmn2r25 UTSW 6 123851982 missense probably benign 0.01
R6826:Vmn2r25 UTSW 6 123823112 missense probably damaging 1.00
R7054:Vmn2r25 UTSW 6 123823610 missense probably damaging 1.00
R7120:Vmn2r25 UTSW 6 123828435 missense possibly damaging 0.51
R7177:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7287:Vmn2r25 UTSW 6 123852081 missense possibly damaging 0.49
X0020:Vmn2r25 UTSW 6 123839400 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCTGATTGTGGTGCTCAC -3'
(R):5'- TCTACATATAGACCTACTGCTAGCATG -3'

Sequencing Primer
(F):5'- TGCTCACCCCAAGTTATTATTTTATC -3'
(R):5'- AGACCTACTGCTAGCATGTATTAGCC -3'
Posted On2015-07-06