Incidental Mutation 'R4367:Tarsl2'
ID325804
Institutional Source Beutler Lab
Gene Symbol Tarsl2
Ensembl Gene ENSMUSG00000030515
Gene Namethreonyl-tRNA synthetase-like 2
SynonymsA530046H20Rik
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location65644898-65692091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65682819 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 556 (T556M)
Ref Sequence ENSEMBL: ENSMUSP00000032728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032728]
Predicted Effect probably damaging
Transcript: ENSMUST00000032728
AA Change: T556M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032728
Gene: ENSMUSG00000030515
AA Change: T556M

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
coiled coil region 44 68 N/A INTRINSIC
Pfam:TGS 151 210 8.8e-14 PFAM
tRNA_SAD 316 365 1.26e-16 SMART
Pfam:tRNA-synt_2b 464 675 2.2e-35 PFAM
Pfam:HGTP_anticodon 687 778 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127354
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Tarsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tarsl2 APN 7 65652259 critical splice acceptor site probably null
IGL00470:Tarsl2 APN 7 65688908 missense probably benign 0.03
IGL00594:Tarsl2 APN 7 65676132 critical splice donor site probably null
IGL01352:Tarsl2 APN 7 65658910 missense possibly damaging 0.80
IGL01519:Tarsl2 APN 7 65663886 missense probably damaging 1.00
IGL01726:Tarsl2 APN 7 65682818 missense possibly damaging 0.46
IGL02370:Tarsl2 APN 7 65661165 missense probably benign 0.17
IGL02729:Tarsl2 APN 7 65682819 missense probably damaging 0.97
IGL03234:Tarsl2 APN 7 65652278 missense probably benign 0.06
gary UTSW 7 65688952 critical splice donor site probably null
smart_money UTSW 7 65678142 missense probably damaging 1.00
R0127:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R0153:Tarsl2 UTSW 7 65684081 missense probably damaging 1.00
R0605:Tarsl2 UTSW 7 65678071 missense probably damaging 1.00
R1070:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1450:Tarsl2 UTSW 7 65647496 missense probably benign 0.01
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R2142:Tarsl2 UTSW 7 65658897 missense probably benign
R2143:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2144:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2145:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2208:Tarsl2 UTSW 7 65682848 missense probably damaging 1.00
R3713:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3715:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3914:Tarsl2 UTSW 7 65683808 missense probably benign 0.05
R3929:Tarsl2 UTSW 7 65684043 intron probably null
R4008:Tarsl2 UTSW 7 65678128 missense probably damaging 1.00
R4064:Tarsl2 UTSW 7 65652270 missense possibly damaging 0.90
R4652:Tarsl2 UTSW 7 65689969 missense probably damaging 1.00
R4825:Tarsl2 UTSW 7 65647554 missense probably benign 0.38
R4901:Tarsl2 UTSW 7 65691294 missense probably benign 0.05
R4999:Tarsl2 UTSW 7 65658935 missense probably damaging 0.99
R5423:Tarsl2 UTSW 7 65683819 missense probably benign 0.00
R5756:Tarsl2 UTSW 7 65675976 missense probably benign 0.22
R5772:Tarsl2 UTSW 7 65684125 missense probably damaging 1.00
R6160:Tarsl2 UTSW 7 65682779 missense probably benign 0.32
R6230:Tarsl2 UTSW 7 65686436 unclassified probably null
R6424:Tarsl2 UTSW 7 65655739 missense probably damaging 1.00
R6615:Tarsl2 UTSW 7 65678142 missense probably damaging 1.00
R6792:Tarsl2 UTSW 7 65662303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCTGGTGTTAAAATCAGGC -3'
(R):5'- TCTTCATATGGTCACCATGGC -3'

Sequencing Primer
(F):5'- AAGAGCACTGCTGTTCTTGCAAG -3'
(R):5'- TATGGTCACCATGGCGACGAG -3'
Posted On2015-07-06