Incidental Mutation 'R4367:Ubqlnl'
ID325805
Institutional Source Beutler Lab
Gene Symbol Ubqlnl
Ensembl Gene ENSMUSG00000051437
Gene Nameubiquilin-like
SynonymsLOC244179, 4922504M18Rik
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104148259-104150556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104149718 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 191 (V191M)
Ref Sequence ENSEMBL: ENSMUSP00000056365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]
PDB Structure
Solution Structure of RSGI RUH-056, a UBA domain from mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000051137
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059121
AA Change: V191M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437
AA Change: V191M

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154555
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal in terms of growth and behavior. Adult males are fertile and show no apparent defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Ubqlnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ubqlnl APN 7 104149165 missense probably benign
IGL01592:Ubqlnl APN 7 104150289 unclassified probably benign
IGL01972:Ubqlnl APN 7 104149697 missense probably benign 0.00
IGL02266:Ubqlnl APN 7 104149547 nonsense probably null
IGL02447:Ubqlnl APN 7 104148649 missense probably damaging 1.00
IGL03232:Ubqlnl APN 7 104148629 missense possibly damaging 0.71
FR4737:Ubqlnl UTSW 7 104149835 unclassified probably benign
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0077:Ubqlnl UTSW 7 104150047 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0517:Ubqlnl UTSW 7 104148638 missense probably damaging 1.00
R1129:Ubqlnl UTSW 7 104149650 missense probably damaging 0.98
R1885:Ubqlnl UTSW 7 104150065 missense possibly damaging 0.88
R1987:Ubqlnl UTSW 7 104148485 missense probably benign
R2151:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2152:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2153:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R3712:Ubqlnl UTSW 7 104149138 missense probably benign 0.03
R3914:Ubqlnl UTSW 7 104149606 missense probably benign
R4404:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4405:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4406:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4407:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4449:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4458:Ubqlnl UTSW 7 104149189 missense probably benign 0.01
R4508:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4516:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4517:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4518:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4522:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4523:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4524:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4529:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4531:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4738:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4739:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4740:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R5339:Ubqlnl UTSW 7 104149765 missense probably benign 0.00
R5357:Ubqlnl UTSW 7 104148931 missense probably damaging 1.00
R5386:Ubqlnl UTSW 7 104149217 missense probably benign 0.01
R5542:Ubqlnl UTSW 7 104149697 nonsense probably null
R5588:Ubqlnl UTSW 7 104149132 missense probably damaging 1.00
R6058:Ubqlnl UTSW 7 104148752 missense probably benign
R6084:Ubqlnl UTSW 7 104148698 missense probably benign 0.01
R6207:Ubqlnl UTSW 7 104148708 missense possibly damaging 0.73
R6794:Ubqlnl UTSW 7 104148785 missense probably benign 0.34
Z1088:Ubqlnl UTSW 7 104149993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATACTCAGGGTTCTGTGC -3'
(R):5'- TGGTAACCAACAATCCCTGC -3'

Sequencing Primer
(F):5'- CTGGCTGCTGGATCTGCATTATC -3'
(R):5'- TCCCTGCCATCAAGACAGG -3'
Posted On2015-07-06